Difference between revisions of "Dimocarpus longan"

From ICG
Jump to navigation Jump to search
 
(4 intermediate revisions by 4 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
[[File:Dimocarpus longan-1.jpg|right|327px|]]
+
[[File:Dimocarpus longan.png|right|200px|link=Dimocarpus longan]]
 
* '''''Dimocarpus longan''''', commonly known as the longan, is a tropical tree that produces edible fruit. It is one of the better-known tropical members of the soapberry family (Sapindaceae). Longan is widely cultivated in Southeast Asia, South Asia, Australia, and Hawaii.  It is an important tropical/subtropical evergreen fruit tree that has a diploid genome (2n = 2x = 30) and belongs to the family Sapindaceae. China's longan acreage and production rank first, accounting for 70% and more than 50% of the world's acreage and production, respectively<ref name="ref1"/><ref name="ref2"/> .
 
* '''''Dimocarpus longan''''', commonly known as the longan, is a tropical tree that produces edible fruit. It is one of the better-known tropical members of the soapberry family (Sapindaceae). Longan is widely cultivated in Southeast Asia, South Asia, Australia, and Hawaii.  It is an important tropical/subtropical evergreen fruit tree that has a diploid genome (2n = 2x = 30) and belongs to the family Sapindaceae. China's longan acreage and production rank first, accounting for 70% and more than 50% of the world's acreage and production, respectively<ref name="ref1"/><ref name="ref2"/> .
 
* <font color=blue>'''Common Name:'''</font> '''Longan'''
 
* <font color=blue>'''Common Name:'''</font> '''Longan'''
Line 6: Line 6:
  
 
=='''''Somatic Embryogenesis'''''==
 
=='''''Somatic Embryogenesis'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 67: Line 67:
 
*'''Institution''': Institute of Horticultural Biotechnology, Fujian Agriculture and Forestry University, Fuzhou, Fujian 350002, China
 
*'''Institution''': Institute of Horticultural Biotechnology, Fujian Agriculture and Forestry University, Fuzhou, Fujian 350002, China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''132''' (Based on Google Scholar [2017-06-23])
+
Cited by [https://scholar.google.com/scholar?cites=4600058501591324795&as_sdt=2005&sciodt=0,5&hl=en '''130'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 78: Line 78:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]]
 
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]]
 
[[Category:EF1α]] [[Category:SOD]] [[Category:Ubiquitin]]
 
[[Category:EF1α]] [[Category:SOD]] [[Category:Ubiquitin]]
 
[[Category:Specific Tissue]]
 
[[Category:Specific Tissue]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]

Latest revision as of 09:47, 1 September 2017

Description

Dimocarpus longan.png
  • Dimocarpus longan, commonly known as the longan, is a tropical tree that produces edible fruit. It is one of the better-known tropical members of the soapberry family (Sapindaceae). Longan is widely cultivated in Southeast Asia, South Asia, Australia, and Hawaii. It is an important tropical/subtropical evergreen fruit tree that has a diploid genome (2n = 2x = 30) and belongs to the family Sapindaceae. China's longan acreage and production rank first, accounting for 70% and more than 50% of the world's acreage and production, respectively[1][2] .
  • Common Name: Longan
  • NCBI Taxonomy

Somatic Embryogenesis

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
UBQ [1] Ubiquitin
  • At different developmental stages at different temperatures
JQ678782
  • F:GCCGACTACAACATCCAGAAG
  • R:GCTTGGTGTAGGTCTTCTTCTT
94 53~64 SYBR
EF-1α[1] Eukaryotic elongation factor 1-alpha
  • At different developmental stages at different temperatures
DQ471426
  • F:GATGATTCCCACCAAGCCCAT
  • R:GGGTCCTTCTTCTCAACACTCT
76 53~64 SYBR
Fe-SOD[1] Iron-superoxide dismutase
  • At different developmental stages at different temperatures
EU330204
  • F:GGTCAGATGGTGAAGCCGTAGAG
  • R:GTCTATGCCACCGATACAACAAACCC
106 53~64 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Z.X. Lai
  • Email: Laizx01@163.com
  • Institution: Institute of Horticultural Biotechnology, Fujian Agriculture and Forestry University, Fuzhou, Fujian 350002, China

Citation Statistics

Cited by 130 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Lin Y L, Lai Z X. Reference gene selection for qPCR analysis during somatic embryogenesis in longan tree[J]. Plant Science, 2010, 178(4): 359-365.
  2. Lin Y, Min J, Lai R, Wu Z, Chen Y, Yu L, Cheng C, Jin Y, Tian Q, Liu Q, Liu W, Zhang C, Lin L, Zhang D, Thu M, Zhang Z, Liu S, Zhong C, Fang X, Wang J, Yang H, Varshney RK, Yin Y, Lai Z.Gigascience. 2017 May 1;6(5):1-14. doi: 10.1093/gigascience/gix023.PMID: 28368449.

Categories