Difference between revisions of "Dimocarpus longan"

From ICG
Jump to navigation Jump to search
 
(14 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
−
 
+
[[File:Dimocarpus longan.png|right|200px|link=Dimocarpus longan]]
−
[[File:Dimocarpus longan-1.jpg|right|327px|]]
+
* '''''Dimocarpus longan''''', commonly known as the longan, is a tropical tree that produces edible fruit. It is one of the better-known tropical members of the soapberry family (Sapindaceae). Longan is widely cultivated in Southeast Asia, South Asia, Australia, and Hawaii. It is an important tropical/subtropical evergreen fruit tree that has a diploid genome (2n = 2x = 30) and belongs to the family Sapindaceae. China's longan acreage and production rank first, accounting for 70% and more than 50% of the world's acreage and production, respectively<ref name="ref1"/><ref name="ref2"/> .
−
* Longan (Dimocarpus longan Lour.), an important subtropical fruit in the family Sapindaceae, is grown in more than 10 countries. Longan is an edible drupe fruit and a source of traditional medicine with polyphenol-rich traits. Tree size, alternate bearing, and witches' broom disease still pose serious problems.
+
* <font color=blue>'''Common Name:'''</font> '''Longan'''
−
* It is originated from South China or Southeast Asia and is commonly called longan or “dragon eye” in Asia. It is an important tropical/subtropical evergreen fruit tree that has a diploid genome (2n = 2x = 30) and belongs to the family Sapindaceae. Longan is widely cultivated in Southeast Asia, South Asia, Australia, and Hawaii.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=128017 <font color=blue>'''NCBI Taxonomy'''</font>]
−
* China's longan acreage and production rank first, accounting for 70% and more than 50% of the world's acreage and production, respectively<ref name="ref1"/> <ref name="ref2"/> .
 
  
 
=='''''Somatic Embryogenesis'''''==
 
=='''''Somatic Embryogenesis'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 14: Line 13:
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! Accession Number  
 
! Accession Number  
−
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 26: Line 25:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GCCGACTACAACATCCAGAAG
 
* F:GCCGACTACAACATCCAGAAG
−
* R:GCTTGGTGTA GGTCTTCTTC TT
+
* R:GCTTGGTGTAGGTCTTCTTCTT
 
|align="center"| 94
 
|align="center"| 94
 
|align="center"| 53~64
 
|align="center"| 53~64
Line 38: Line 37:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GATGATTCCCACCAAGCCCAT
 
* F:GATGATTCCCACCAAGCCCAT
−
* R:GGGTCCTTCT TCTCAACACT CT
+
* R:GGGTCCTTCTTCTCAACACTCT
 
|align="center"| 76
 
|align="center"| 76
 
|align="center"| 53~64
 
|align="center"| 53~64
Line 49: Line 48:
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EU330204 '''EU330204''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EU330204 '''EU330204''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
−
* F:GGTCAGATGG TGAAGCCGTA GAG
+
* F:GGTCAGATGGTGAAGCCGTAGAG
 
* R:GTCTATGCCACCGATACAACAAACCC
 
* R:GTCTATGCCACCGATACAACAAACCC
 
|align="center"| 106
 
|align="center"| 106
Line 56: Line 55:
 
|}
 
|}
  
−
===Moleculer Type===
+
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 67: Line 67:
 
*'''Institution''': Institute of Horticultural Biotechnology, Fujian Agriculture and Forestry University, Fuzhou, Fujian 350002, China
 
*'''Institution''': Institute of Horticultural Biotechnology, Fujian Agriculture and Forestry University, Fuzhou, Fujian 350002, China
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''131''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=4600058501591324795&as_sdt=2005&sciodt=0,5&hl=en '''130'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 78: Line 78:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]]
 
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]]
 
[[Category:EF1α]] [[Category:SOD]] [[Category:Ubiquitin]]
 
[[Category:EF1α]] [[Category:SOD]] [[Category:Ubiquitin]]
 +
[[Category:Specific Tissue]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]

Latest revision as of 09:47, 1 September 2017

Description

Dimocarpus longan.png
  • Dimocarpus longan, commonly known as the longan, is a tropical tree that produces edible fruit. It is one of the better-known tropical members of the soapberry family (Sapindaceae). Longan is widely cultivated in Southeast Asia, South Asia, Australia, and Hawaii. It is an important tropical/subtropical evergreen fruit tree that has a diploid genome (2n = 2x = 30) and belongs to the family Sapindaceae. China's longan acreage and production rank first, accounting for 70% and more than 50% of the world's acreage and production, respectively[1][2] .
  • Common Name: Longan
  • NCBI Taxonomy

Somatic Embryogenesis

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
UBQ [1] Ubiquitin
  • At different developmental stages at different temperatures
 JQ678782
  • F:GCCGACTACAACATCCAGAAG
  • R:GCTTGGTGTAGGTCTTCTTCTT
 94 53~64 SYBR
EF-1α[1] Eukaryotic elongation factor 1-alpha
  • At different developmental stages at different temperatures
 DQ471426
  • F:GATGATTCCCACCAAGCCCAT
  • R:GGGTCCTTCTTCTCAACACTCT
 76 53~64 SYBR
Fe-SOD[1] Iron-superoxide dismutase
  • At different developmental stages at different temperatures
 EU330204
  • F:GGTCAGATGGTGAAGCCGTAGAG
  • R:GTCTATGCCACCGATACAACAAACCC
 106 53~64 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Z.X. Lai
  • Email: Laizx01@163.com
  • Institution: Institute of Horticultural Biotechnology, Fujian Agriculture and Forestry University, Fuzhou, Fujian 350002, China

Citation Statistics

Cited by 130 (Based on Google Scholar [2017-09-01])

References

  1. ↑ 1.0 1.1 1.2 1.3 Lin Y L, Lai Z X. Reference gene selection for qPCR analysis during somatic embryogenesis in longan tree[J]. Plant Science, 2010, 178(4): 359-365.
  2. ↑ Lin Y, Min J, Lai R, Wu Z, Chen Y, Yu L, Cheng C, Jin Y, Tian Q, Liu Q, Liu W, Zhang C, Lin L, Zhang D, Thu M, Zhang Z, Liu S, Zhong C, Fang X, Wang J, Yang H, Varshney RK, Yin Y, Lai Z.Gigascience. 2017 May 1;6(5):1-14. doi: 10.1093/gigascience/gix023.PMID: 28368449.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Dimocarpus_longan&oldid=8850"