Dimocarpus longan

Description

• Dimocarpus longan, commonly known as the longan, is a tropical tree that produces edible fruit. It is one of the better-known tropical members of the soapberry family (Sapindaceae). Longan is widely cultivated in Southeast Asia, South Asia, Australia, and Hawaii. It is an important tropical/subtropical evergreen fruit tree that has a diploid genome (2n = 2x = 30) and belongs to the family Sapindaceae. China's longan acreage and production rank first, accounting for 70% and more than 50% of the world's acreage and production, respectively .
• Common Name: Longan
• NCBI Taxonomy

Somatic Embryogenesis

Reference Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
UBQ	Ubiquitin	At different developmental stages at different temperatures	JQ678782	F:GCCGACTACAACATCCAGAAG R:GCTTGGTGTAGGTCTTCTTCTT	94	53~64	SYBR
EF-1α	Eukaryotic elongation factor 1-alpha	At different developmental stages at different temperatures	DQ471426	F:GATGATTCCCACCAAGCCCAT R:GGGTCCTTCTTCTCAACACTCT	76	53~64	SYBR
Fe-SOD	Iron-superoxide dismutase	At different developmental stages at different temperatures	EU330204	F:GGTCAGATGGTGAAGCCGTAGAG R:GTCTATGCCACCGATACAACAAACCC	106	53~64	SYBR

Molecular Types

• mRNA

Evaluation Methods

• geNorm method && Related Reference
• NormFinder method && Related Reference
• BestKeeper method && Related Reference

Contact

• Name: Z.X. Lai
• Email: Laizx01@163.com
• Institution: Institute of Horticultural Biotechnology, Fujian Agriculture and Forestry University, Fuzhou, Fujian 350002, China

Citation Statistics

Cited by 132 (Based on Google Scholar [2017-06-23])