Dimocarpus longan

From ICG
Jump to navigation Jump to search

Description

Dimocarpus longan-1.jpg
  • Dimocarpus longan, commonly known as the longan, is a tropical tree that produces edible fruit. It is one of the better-known tropical members of the soapberry family (Sapindaceae). Longan is widely cultivated in Southeast Asia, South Asia, Australia, and Hawaii. It is an important tropical/subtropical evergreen fruit tree that has a diploid genome (2n = 2x = 30) and belongs to the family Sapindaceae. China's longan acreage and production rank first, accounting for 70% and more than 50% of the world's acreage and production, respectively[1][1] .
  • Common Name: Longan
  • NCBI Taxonomy

Somatic Embryogenesis

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
UBQ [2] Ubiquitin
  • At different developmental stages at different temperatures
JQ678782
  • F:GCCGACTACAACATCCAGAAG
  • R:GCTTGGTGTAGGTCTTCTTCTT
94 53~64 SYBR
EF-1α[2] Eukaryotic elongation factor 1-alpha
  • At different developmental stages at different temperatures
DQ471426
  • F:GATGATTCCCACCAAGCCCAT
  • R:GGGTCCTTCTTCTCAACACTCT
76 53~64 SYBR
Fe-SOD[2] Iron-superoxide dismutase
  • At different developmental stages at different temperatures
EU330204
  • F:GGTCAGATGGTGAAGCCGTAGAG
  • R:GTCTATGCCACCGATACAACAAACCC
106 53~64 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Z.X. Lai
  • Email: Laizx01@163.com
  • Institution: Institute of Horticultural Biotechnology, Fujian Agriculture and Forestry University, Fuzhou, Fujian 350002, China

Citation Statistics

Cited by 132 (Based on Google Scholar [2017-06-23])

References

  1. 1.0 1.1 Cite error: Invalid <ref> tag; no text was provided for refs named
  2. 2.0 2.1 2.2 Lin Y L, Lai Z X. Reference gene selection for qPCR analysis during somatic embryogenesis in longan tree[J]. Plant Science, 2010, 178(4): 359-365.

Cite error: <ref> tag with name "ref2" defined in <references> is not used in prior text.