Dimocarpus longan

From ICG
Jump to navigation Jump to search

Description

Somatic Embryogenesis

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
UBQ [1] Ubiquitin
  • at different developmental stages at different temperatures
JQ678782
  • F:GCCGACTACAACATCCAGAAG
  • R:GCTTGGTGTA GGTCTTCTTC TT
94 53~64 SYBR
EF-1α[1] Eukaryotic elongation factor 1-alpha
  • at different developmental stages at different temperatures
DQ471426
  • F:GATGATTCCCACCAAGCCCAT
  • R:GGGTCCTTCT TCTCAACACT CT
76 53~64 SYBR
Fe-SOD[1] Iron-superoxide dismutase
  • at different developmental stages at different temperatures
EU330204
  • F:GGTCAGATGG TGAAGCCGTA GAG
  • R:GTCTATGCCACCGATACAACAAACCC
106 53~64 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Z.X. Lai
  • Email: Laizx01@163.com
  • Institution: Institute of Horticultural Biotechnology, Fujian Agriculture and Forestry University, Fuzhou, Fujian 350002, China

References

  1. 1.0 1.1 1.2 Lin Y L, Lai Z X. Reference gene selection for qPCR analysis during somatic embryogenesis in longan tree[J]. Plant Science, 2010, 178(4): 359-365.