Diploptera punctata

From ICG
Jump to navigation Jump to search

Description

Diploptera punctata.png
  • Diploptera punctata is a tropical omnivorous cockroach found in ground litter or burrowing under rocks and logs, is currently known to be truly viviparous. D. punctata embryos develop within the body cavity of females in the brood sac, an invagination of the ventral intersegmental membrane which provides nutritive secretions (milk) to the developing embryos. The main components of this milk are hydrosoluble proteins, rich in many essential amino acids, particularly leucine, valine, and lysine, but deficient in methionine and tryptophan. Methionine and tryptophan are presumably acquired from the vertically transmitted Blattabacterium present in the fat body of developing embryos, or possibly from gut microbiota. The cockroach Diploptera punctata has proven to be an ideal model organism in the study of juvenile hormone (JH). D. punctata is the only known truly viviparous cockroach. Because of this remarkable feature, the rate of JH production is tightly controlled during the animal’s reproductive cycle. High rates of JH biosynthesis in their CA are coordinated with a very precise and predictable order of reproductive events, making this cockroach an ideal model for studying the regulation of JH production[1] [2].
  • Common Name: Pacific beetle cockroach
  • NCBI Taxonomy

During Gonadotrophic Cycle

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Arm[1] Armadillo
  • Universal reference gene
KC149902
  • F:GCTACTGCACCACTCACAGAATTATT
  • R:CTGCAGCATACGTTGCAACA
64 60 SYBR
EF1a[1] Elongation factor 1 alpha
  • Universal reference gene
JQ086311
  • F:TCGTCTTCCTCTGCAGGATGTCT
  • R:GGGTGCAAATGTCACAACCATACC
109 60 SYBR
Tub[1] α-tubulin
  • Ovary
KC149906
  • F:AAATTACCAACGCTTGCTTTGAA
  • R:TGGCGAGGATCGCATTTT
58 60 SYBR
RpL32[1] Ribosomal protein L32
  • Ovary
KC149903
  • F:GCGCTTCAAGGGCCAGTAC
  • R:TGCTTGGTTTTCTTATTGCTACCA
63 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Stephen S Tobe
  • Email: stephen.tobe@utoronto.ca
  • Institution: Department of Cell and Systems Biology, University of Toronto, 25 Harbord Street, Toronto, Canada

Citation Statistics

Cited by 18 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 1.4 Marchal E, Hult E F, Huang J, et al. Sequencing and validation of housekeeping genes for quantitative real-time PCR during the gonadotrophic cycle of Diploptera punctata[J]. BMC research notes, 2013, 6(1): 237.
  2. Ayayee PA, Keeney G, Sabree ZL, Mu?oz-Garcia A. Compositional differences among female-associated and embryo-associated microbiota of the viviparous Pacific Beetle cockroach, Diploptera punctata. FEMS Microbiol Ecol. 2017 Apr 18. doi: 10.1093/femsec/fix052.