Drosophila melanogaster

From ICG
Jump to navigation Jump to search

Description

REFqPCRDrosophilamelanogaster.jpg
  • The fruit fly, Drosophila melanogaster, is one of the most important models used for deploying molecular techniques to address physiological questions.
  • Drosophila is a complex multicellular organism in which many aspects of development, physiology, innate immunity and behavior parallel those in mammals and other groups.
  • These advantages have enabled research in Drosophila to make important contributions to the understanding of fundamental biological processes and medical science.

Physiological Responses

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Actin[1][2] Actin42A
  • Injured
  • Heat-stressed
  • Fed different diets
CG12051
  • F:GCGTCGGTCAATTCAATCTT
  • R:AAGCTGCAACCTCTTCGTCA
138 60.08 SYBR
EF1[1] Elongation Factor 1 alpha100
  • Injured
  • Heat-stressed
  • Fed different diets
CG1873
  • F:GCGTGGGTTTGTGATCAGTT
  • R:GATCTTCTCCTTGCCCATCC
125 60.94 SYBR
Mnf[1] Forkhead domain 68A
  • Injured
  • Heat-stressed
  • Fed different diets
CG11799
  • F:AAGACAGTCAGTTTCGTGCCACCTGA
  • R:TCCATGCGTGTTCTACCCAACTCCTT
66 59.83 SYBR
Rpl32[1] Ribosomal protein L32
  • Injured
  • Heat-stressed
  • Fed different diets
CG7939
  • F:ATGCTAAGCTGTCGCACAAATG
  • R:GTTCGATCCGTAACCGATGT
107 59.82 SYBR
Rps20[1] Ribosomal Protein S20
  • Injured
  • Heat-stressed
  • Fed different diets
CG15693
  • F:TGTGGTGAGGGTTCCAAGAC
  • R:GACGATCTCAGAGGGCGAGT
87 60.97 SYBR
Tubulin[1] Alpha-tubulin at 84B
  • Injured
  • Heat-stressed
  • Fed different diets
CG1913
  • F:TGTCGCGTGTGAAACACTTC
  • R:AGCAGGCGTTTCCAATCTG
96 60.9 SYBR
18S[1] Small ribosomal submit
  • Injured
  • Heat-stressed
  • Fed different diets
CG8900
  • F:CTGAGAAACGGCTACCACATC
  • R:ACCAGACTTGCCCTCCAAT
171 59.52 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Fleur Ponton
  • Email: fleur_ponton@hotmail.com, fponton@sydney.edu.au
  • Institute: School of Biological Sciences, Heydon-Laurence building - A08, The University of Sydney, NSW 2006, Australia

Citation Statistics

Cited by 133 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Ponton F, Chapuis M P, Pernice M, et al. Evaluation of potential reference genes for reverse transcription-qPCR studies of physiological responses in Drosophila melanogaster[J]. Journal of insect physiology, 2011, 57(6): 840-850.
  2. Fleur Ponton. Author links open the author workspace. Evaluation of potential reference genes for reverse transcription-qPCR studies of physiological responses in Drosophila melanogaster. J Insect Physiol. 2011 Jun;57(6):840-50. doi: 10.1016/j.jinsphys.2011.03.014. Epub 2011 Mar 22.