Drosophila melanogaster

From ICG
Jump to navigation Jump to search

Description

Physiological Responses

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Actin[1] Actin42A
  • injured
  • heat-stressed
  • fed different diets
CG12051
  • F:GCGTCGGTCAATTCAATCTT
  • R:AAGCTGCAACCTCTTCGTCA
138 60.08 SYBR
EF1[1] Elongation Factor 1 alpha100
  • injured
  • heat-stressed
  • fed different diets
CG1873
  • F:GCGTGGGTTTGTGATCAGTT
  • R:GATCTTCTCCTTGCCCATCC
125 60.94 SYBR
Mnf[1] Forkhead domain 68A
  • injured
  • heat-stressed
  • fed different diets
CG11799
  • F:AAGACAGTCAGTTTCGTGCCACCTGA
  • R:TCCATGCGTGTTCTACCCAACTCCTT
66 59.83 SYBR
Rpl32[1] Ribosomal protein L32
  • injured
  • heat-stressed
  • fed different diets
CG7939
  • F:ATGCTAAGCTGTCGCACAAATG
  • R:GTTCGATCCGTAACCGATGT
107 59.82 SYBR
Rps20[1] Ribosomal Protein S20
  • injured
  • heat-stressed
  • fed different diets
CG15693
  • F:TGTGGTGAGGGTTCCAAGAC
  • R:GACGATCTCAGAGGGCGAGT
87 60.97 SYBR
Tubulin[1] Alpha-tubulin at 84B
  • injured
  • heat-stressed
  • fed different diets
CG1913
  • F:TGTCGCGTGTGAAACACTTC
  • R:AGCAGGCGTTTCCAATCTG
96 60.9 SYBR
18S[1] Small ribosomal submit
  • injured
  • heat-stressed
  • fed different diets
CG8900
  • F:CTGAGAAACGGCTACCACATC
  • R:ACCAGACTTGCCCTCCAAT
171 59.52 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Fleur Ponton
  • Email: fleur_ponton@hotmail.com, fponton@sydney.edu.au
  • Institute: School of Biological Sciences, Heydon-Laurence building - A08, The University of Sydney, NSW 2006, Australia

Citation Statistics

Cited by 133 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Ponton F, Chapuis M P, Pernice M, et al. Evaluation of potential reference genes for reverse transcription-qPCR studies of physiological responses in Drosophila melanogaster[J]. Journal of insect physiology, 2011, 57(6): 840-850.