Drosophila melanogaster

Description

Drosophila melanogaster is a species of fly in the family Drosophilidae. It is known generally as the common fruit fly or vinegar fly and a model organism. It is widely used for biological research in studies of genetics, physiology, microbial pathogenesis, innate immunity and life history evolution. These advantages have enabled research in Drosophila important for fundamental biological processes and medical science^[1].
Common Name: Vinegar fly
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
Actin^[1]	Actin42A	Injured Heat-stressed Fed different diets	CG12051	F:GCGTCGGTCAATTCAATCTT R:AAGCTGCAACCTCTTCGTCA	138	60.08	SYBR
EF1^[1]	Elongation Factor 1 alpha100	Injured Heat-stressed Fed different diets	CG1873	F:GCGTGGGTTTGTGATCAGTT R:GATCTTCTCCTTGCCCATCC	125	60.94	SYBR
Mnf^[1]	Forkhead domain 68A	Injured Heat-stressed Fed different diets	CG11799	F:AAGACAGTCAGTTTCGTGCCACCTGA R:TCCATGCGTGTTCTACCCAACTCCTT	66	59.83	SYBR
Rpl32^[1]	Ribosomal protein L32	Injured Heat-stressed Fed different diets	CG7939	F:ATGCTAAGCTGTCGCACAAATG R:GTTCGATCCGTAACCGATGT	107	59.82	SYBR
Rps20^[1]	Ribosomal Protein S20	Injured Heat-stressed Fed different diets	CG15693	F:TGTGGTGAGGGTTCCAAGAC R:GACGATCTCAGAGGGCGAGT	87	60.97	SYBR
Tubulin^[1]	Alpha-tubulin at 84B	Injured Heat-stressed Fed different diets	CG1913	F:TGTCGCGTGTGAAACACTTC R:AGCAGGCGTTTCCAATCTG	96	60.9	SYBR
18S^[1]	Small ribosomal submit	Injured Heat-stressed Fed different diets	CG8900	F:CTGAGAAACGGCTACCACATC R:ACCAGACTTGCCCTCCAAT	171	59.52	SYBR

Name: Fleur Ponton
Email: fleur_ponton@hotmail.com, fponton@sydney.edu.au
Institution: School of Biological Sciences, Heydon-Laurence building - A08, The University of Sydney, NSW 2006, Australia

Cited by 144 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 Ponton F, Chapuis M P, Pernice M, et al. Evaluation of potential reference genes for reverse transcription-qPCR studies of physiological responses in Drosophila melanogaster[J]. Journal of insect physiology, 2011, 57(6): 840-850.