Difference between revisions of "Elaeis guineensis"

From ICG
Jump to navigation Jump to search
(Created page with "==Description== right|327px| * The African oil palm (Elaeis guineensis), which is grown in tropical and subtropical regions, is a highly producti...")
 
Line 78: Line 78:
 
*'''Email''': zjxiawei@gmail.com
 
*'''Email''': zjxiawei@gmail.com
 
*'''Institution''': Hainan Key Laboratory of Tropical Oil Crops Biology/Coconuts Research Institute, Chinese Academy of Tropical Agricultural Sciences, Wenchang, Hainan 571339, PR China
 
*'''Institution''': Hainan Key Laboratory of Tropical Oil Crops Biology/Coconuts Research Institute, Chinese Academy of Tropical Agricultural Sciences, Wenchang, Hainan 571339, PR China
 +
 +
===Citation Statistics===
 +
Cited by '''12''' (Based on Google Scholar [2017-06-16])
  
 
=='''References'''==
 
=='''References'''==
Line 88: Line 91:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
[[Category:Plants]]

Revision as of 08:08, 16 June 2017

Description

REFqPCR2014001-1.jpg
  • The African oil palm (Elaeis guineensis), which is grown in tropical and subtropical regions, is a highly productive oil-bearing crop.
  • The African oil palm (Elaeis guineensis), belonging to genus Elaeis in the family Arecaceae (Palmaceae), is the most productive oil- bearing crop grown in tropical and subtropical regions, accounting for 33% of vegetable oil and 45% of edible oil produced worldwide. Oil palm has a long productive life span and is frequently exposed to soil and atmospheric drought and other stresses.
  • Elaeis guineensis (E. guineensis) is the most productive oil variety that can produced 10–35 tonnes/ha of crude fruit bunch oil. It grows well in low land with humid places and tropical perennial plants which can cultivated easily in Malaysia. It is easy to get and readily available in the market. [1] [2].

Various Stresses

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
eIF1[1] Eukaryotic initiation factor 4A
  • Cold, drought and salinity treatments
GAJH01031684.1
  • F:CCTCACCTATACTCTTCCCACCA
  • R:GTCATCGCCCAGGCACAG
97 85.3 ± 0.18 SYBR
eIF2[1] Eukaryotic initiation factor 4A
  • Cold, drought and salinity treatments
GAJH01015579.1
  • F:ATTAGGATGTTTGTGCTGGAT
  • R:CTCAGGAGGCATTGTGGC
106 81.72 ± 0.16 SYBR
APT[1] Adenine phosphoribosyltransferase
  • Drought and salinity stress
GAJH01036635.1
  • F:GTTTCAGGACATCACGACGCT
  • R:TAAGGCAATAGGGGGACCG
102 82.34 ± 0.14 SYBR
cyc[1] Cyclophilin
  • Drought and salinity stress
GAJH01023806.1
  • F:AGGGCTGTATGGGGATGATGT
  • R:GCTTTTACCTCCAGTTCCATTTC
94 82.88 ± 0.14 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Wei Xia
  • Email: zjxiawei@gmail.com
  • Institution: Hainan Key Laboratory of Tropical Oil Crops Biology/Coconuts Research Institute, Chinese Academy of Tropical Agricultural Sciences, Wenchang, Hainan 571339, PR China

Citation Statistics

Cited by 12 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 1.4 Xia W, Mason AS, Xiao Y, et al. (2014) Analysis of multiple transcriptomes of the African oil palm (Elaeis guineensis) to identify reference genes for RT-qPCR. J Biotechnol 184, 63-73.
  2. Teo SH, Rashid U, Choong SYT, Taufiq-Yap YH (2017) Heterogeneous calcium-based bimetallic oxide catalyzed transesterification of Elaeis guineensis derived triglycerides for biodiesel production. Energy Conversion and Management 141, 20-27