Difference between revisions of "Elaeis guineensis"
Jump to navigation
Jump to search
ICG Expert4 (talk | contribs) |
|||
Line 81: | Line 81: | ||
===Citation Statistics=== | ===Citation Statistics=== | ||
Cited by '''12''' (Based on Google Scholar [2017-06-16]) | Cited by '''12''' (Based on Google Scholar [2017-06-16]) | ||
+ | |||
+ | =='''Tissue Culture'''== | ||
+ | |||
+ | ===Reference Genes=== | ||
+ | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
+ | |- | ||
+ | ! Gene Symbol | ||
+ | ! Gene Name | ||
+ | ! style="width=25% font-size:9pt "|Application Scope | ||
+ | ! Accession Number | ||
+ | ! Primer | ||
+ | ! Size [bp] | ||
+ | ! Tm [℃] | ||
+ | ! Detection | ||
+ | |- | ||
+ | |align="center"| PD00380<ref name="ref1"/> | ||
+ | |align="center"| Predicted 40S ribosomal protein S27-2 | ||
+ | | | ||
+ | *Tissue Culture | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/EY397675 '''EY397675'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:GATGGTTCTTCCGAACGATATTGA | ||
+ | * R:TCACATCCATGAAGAATGAGTTCG | ||
+ | |align="center"| 113 | ||
+ | |align="center"| 63 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| PD00569<ref name="ref1"/> | ||
+ | |align="center"| Manganese superoxide dismutase | ||
+ | | | ||
+ | *Tissue Culture | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/EL682210 '''EL682210'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CACCACCAGACGTACATCACAAA | ||
+ | * R:GATATGACCTCCGCCATTGAACT | ||
+ | |align="center"| 129 | ||
+ | |align="center"| 60 | ||
+ | |align="center"| SYBR | ||
+ | |} | ||
+ | ===Moleculer Type=== | ||
+ | * mRNA | ||
+ | ===Evaluation Methods=== | ||
+ | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
+ | * [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference'''] | ||
+ | * [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference'''] | ||
+ | ===Contact=== | ||
+ | *'''Name''': Pek-Lan Chan | ||
+ | *'''Email''': chanpl@mpob.gov.my | ||
+ | *'''Institution''': Advanced Biotechnology and Breeding Centre, Malaysian Palm Oil Board (MPOB), No. 6, Persiaran Institusi, Bandar Baru Bangi, Kajang, Selangor, Malaysia | ||
=='''References'''== | =='''References'''== |
Revision as of 09:19, 16 June 2017
Contents
Description
- The African oil palm (Elaeis guineensis), which is grown in tropical and subtropical regions, is a highly productive oil-bearing crop.
- The African oil palm (Elaeis guineensis), belonging to genus Elaeis in the family Arecaceae (Palmaceae), is the most productive oil- bearing crop grown in tropical and subtropical regions, accounting for 33% of vegetable oil and 45% of edible oil produced worldwide. Oil palm has a long productive life span and is frequently exposed to soil and atmospheric drought and other stresses.
- Elaeis guineensis (E. guineensis) is the most productive oil variety that can produced 10–35 tonnes/ha of crude fruit bunch oil. It grows well in low land with humid places and tropical perennial plants which can cultivated easily in Malaysia. It is easy to get and readily available in the market. [1] [2].
Various Stresses
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
eIF1[1] | Eukaryotic initiation factor 4A |
|
GAJH01031684.1 |
|
97 | 85.3 ± 0.18 | SYBR |
eIF2[1] | Eukaryotic initiation factor 4A |
|
GAJH01015579.1 |
|
106 | 81.72 ± 0.16 | SYBR |
APT[1] | Adenine phosphoribosyltransferase |
|
GAJH01036635.1 |
|
102 | 82.34 ± 0.14 | SYBR |
cyc[1] | Cyclophilin |
|
GAJH01023806.1 |
|
94 | 82.88 ± 0.14 | SYBR |
Moleculer Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Wei Xia
- Email: zjxiawei@gmail.com
- Institution: Hainan Key Laboratory of Tropical Oil Crops Biology/Coconuts Research Institute, Chinese Academy of Tropical Agricultural Sciences, Wenchang, Hainan 571339, PR China
Citation Statistics
Cited by 12 (Based on Google Scholar [2017-06-16])
Tissue Culture
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
PD00380[1] | Predicted 40S ribosomal protein S27-2 |
|
EY397675 |
|
113 | 63 | SYBR |
PD00569[1] | Manganese superoxide dismutase |
|
EL682210 |
|
129 | 60 | SYBR |
Moleculer Type
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Pek-Lan Chan
- Email: chanpl@mpob.gov.my
- Institution: Advanced Biotechnology and Breeding Centre, Malaysian Palm Oil Board (MPOB), No. 6, Persiaran Institusi, Bandar Baru Bangi, Kajang, Selangor, Malaysia
References
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Xia W, Mason AS, Xiao Y, et al. (2014) Analysis of multiple transcriptomes of the African oil palm (Elaeis guineensis) to identify reference genes for RT-qPCR. J Biotechnol 184, 63-73.
- ↑ Teo SH, Rashid U, Choong SYT, Taufiq-Yap YH (2017) Heterogeneous calcium-based bimetallic oxide catalyzed transesterification of Elaeis guineensis derived triglycerides for biodiesel production. Energy Conversion and Management 141, 20-27