Difference between revisions of "Elaeis guineensis"

From ICG
Jump to navigation Jump to search
 
(21 intermediate revisions by 9 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
−
[[File:REFqPCR2014001-1.jpg|right|327px|]]
+
[[File:Elaeis guineensis.png|right|200px|link=Elaeis guineensis]]
−
* The African oil palm (Elaeis guineensis), which is grown in tropical and subtropical regions, is a highly productive oil-bearing crop.
+
* '''''Elaeis guineensis''''' belongs to genus Elaeis in the family Arecaceae (Palmaceae). It a highly productive oil-bearing crop that is mainly grown in tropical and subtropical regions, accounting for 33% of vegetable oil and 45% of edible oil produced worldwide. It has a long productive life span and grows well in low land with humid places and tropical perennial plants can be cultivated easily in Malaysia. However, it is frequently exposed to soil and atmospheric drought and other stresses<ref name="ref1"/><ref name="ref2"/><ref name="ref3"/>.
−
* The African oil palm (Elaeis guineensis), belonging to genus Elaeis in the family Arecaceae (Palmaceae), is the most productive oil- bearing crop grown in tropical and subtropical regions, accounting for 33% of vegetable oil and 45% of edible oil produced worldwide. Oil palm has a long productive life span and is frequently exposed to soil and atmospheric drought and other stresses.
+
* <font color=blue>'''Common Name:'''</font> '''African oil palm''', '''Macaw-fat'''
−
* Elaeis guineensis (E. guineensis) is the most productive oil variety that can produced 10–35 tonnes/ha of crude fruit bunch oil. It grows well in low land with humid places and tropical perennial plants which can cultivated easily in Malaysia. It is easy to get and readily available in the market. <ref name="ref1"/> <ref name="ref2"/><ref name="ref3"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=51953 <font color=blue>'''NCBI Taxonomy'''</font>]
  
−
=='''''Various Stresses'''''==
+
=='''''Abiotic Stress'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 13: Line 13:
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! style="width=25%　font-size:9pt　"|Application Scope  
 
! Accession Number  
 
! Accession Number  
−
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 67: Line 67:
 
|}
 
|}
  
−
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 80: Line 81:
  
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''12''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=14530537738325857795&as_sdt=2005&sciodt=0,5&hl=en '''13'''] (Based on Google Scholar [2017-09-01])
  
−
=='''Tissue Culture'''==
+
=='''''Tissue Culture'''''==
  
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 121: Line 122:
 
|}
 
|}
  
−
===Moleculer Type===
+
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 131: Line 133:
 
*'''Email''': chanpl@mpob.gov.my
 
*'''Email''': chanpl@mpob.gov.my
 
*'''Institution''': Advanced Biotechnology and Breeding Centre, Malaysian Palm Oil Board (MPOB), No. 6, Persiaran Institusi, Bandar Baru Bangi, Kajang, Selangor, Malaysia
 
*'''Institution''': Advanced Biotechnology and Breeding Centre, Malaysian Palm Oil Board (MPOB), No. 6, Persiaran Institusi, Bandar Baru Bangi, Kajang, Selangor, Malaysia
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=9502973521388377307&as_sdt=2005&sciodt=0,5&hl=en '''13'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 144: Line 148:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]]
 
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]]
 +
[[Category:APT]] [[Category:Cyclophilin]] [[Category:eIF]] [[Category:eIF]]
 +
[[Category:Salinity Treatment]]  [[Category:Abiotic Stress]]  [[Category:Different Developmental Stages]]  [[Category:Tissue Culture]]  [[Category:Drought Treatment]]  [[Category:Cold Treatment]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]

Latest revision as of 09:49, 1 September 2017

Description

Elaeis guineensis.png
  • Elaeis guineensis belongs to genus Elaeis in the family Arecaceae (Palmaceae). It a highly productive oil-bearing crop that is mainly grown in tropical and subtropical regions, accounting for 33% of vegetable oil and 45% of edible oil produced worldwide. It has a long productive life span and grows well in low land with humid places and tropical perennial plants can be cultivated easily in Malaysia. However, it is frequently exposed to soil and atmospheric drought and other stresses[1][2][3].
  • Common Name: African oil palm, Macaw-fat
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
eIF1[1] Eukaryotic initiation factor 4A
  • Cold, drought and salinity treatments
 GAJH01031684.1
  • F:CCTCACCTATACTCTTCCCACCA
  • R:GTCATCGCCCAGGCACAG
 97 85.3 ± 0.18 SYBR
eIF2[1] Eukaryotic initiation factor 4A
  • Cold, drought and salinity treatments
 GAJH01015579.1
  • F:ATTAGGATGTTTGTGCTGGAT
  • R:CTCAGGAGGCATTGTGGC
 106 81.72 ± 0.16 SYBR
APT[1] Adenine phosphoribosyltransferase
  • Drought and salinity stress
 GAJH01036635.1
  • F:GTTTCAGGACATCACGACGCT
  • R:TAAGGCAATAGGGGGACCG
 102 82.34 ± 0.14 SYBR
cyc[1] Cyclophilin
  • Drought and salinity stress
 GAJH01023806.1
  • F:AGGGCTGTATGGGGATGATGT
  • R:GCTTTTACCTCCAGTTCCATTTC
 94 82.88 ± 0.14 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Wei Xia
  • Email: zjxiawei@gmail.com
  • Institution: Hainan Key Laboratory of Tropical Oil Crops Biology/Coconuts Research Institute, Chinese Academy of Tropical Agricultural Sciences, Wenchang, Hainan 571339, PR China

Citation Statistics

Cited by 13 (Based on Google Scholar [2017-09-01])

Tissue Culture

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
PD00380[2] Predicted 40S ribosomal protein S27-2
  • Tissue Culture
 EY397675
  • F:GATGGTTCTTCCGAACGATATTGA
  • R:TCACATCCATGAAGAATGAGTTCG
 113 63 SYBR
PD00569[2] Manganese superoxide dismutase
  • Tissue Culture
 EL682210
  • F:CACCACCAGACGTACATCACAAA
  • R:GATATGACCTCCGCCATTGAACT
 129 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Pek-Lan Chan
  • Email: chanpl@mpob.gov.my
  • Institution: Advanced Biotechnology and Breeding Centre, Malaysian Palm Oil Board (MPOB), No. 6, Persiaran Institusi, Bandar Baru Bangi, Kajang, Selangor, Malaysia

Citation Statistics

Cited by 13 (Based on Google Scholar [2017-09-01])

References

  1. ↑ 1.0 1.1 1.2 1.3 1.4 Xia W, Mason AS, Xiao Y, et al. (2014) Analysis of multiple transcriptomes of the African oil palm (Elaeis guineensis) to identify reference genes for RT-qPCR. J Biotechnol 184, 63-73.
  2. ↑ 2.0 2.1 2.2 Chan P L, Rose R J, Murad A M A, et al. Evaluation of reference genes for quantitative real-time PCR in oil palm elite planting materials propagated by tissue culture[J]. PloS one, 2014, 9(6): e99774.
  3. ↑ Teo SH, Rashid U, Choong SYT, Taufiq-Yap YH (2017) Heterogeneous calcium-based bimetallic oxide catalyzed transesterification of Elaeis guineensis derived triglycerides for biodiesel production. Energy Conversion and Management 141, 20-27

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Elaeis_guineensis&oldid=8852"