Difference between revisions of "Elaeis guineensis"
Jump to navigation
Jump to search
ICG Expert4 (talk | contribs) (Created page with "==Description== right|327px| * The African oil palm (Elaeis guineensis), which is grown in tropical and subtropical regions, is a highly producti...") |
Wangzhennan (talk | contribs) |
||
(28 intermediate revisions by 9 users not shown) | |||
Line 1: | Line 1: | ||
==Description== | ==Description== | ||
− | [[File: | + | [[File:Elaeis guineensis.png|right|200px|link=Elaeis guineensis]] |
− | * | + | * '''''Elaeis guineensis''''' belongs to genus Elaeis in the family Arecaceae (Palmaceae). It a highly productive oil-bearing crop that is mainly grown in tropical and subtropical regions, accounting for 33% of vegetable oil and 45% of edible oil produced worldwide. It has a long productive life span and grows well in low land with humid places and tropical perennial plants can be cultivated easily in Malaysia. However, it is frequently exposed to soil and atmospheric drought and other stresses<ref name="ref1"/><ref name="ref2"/><ref name="ref3"/>. |
− | + | * <font color=blue>'''Common Name:'''</font> '''African oil palm''', '''Macaw-fat''' | |
− | + | * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=51953 <font color=blue>'''NCBI Taxonomy'''</font>] | |
− | ==''''' | + | =='''''Abiotic Stress'''''== |
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 13: | Line 13: | ||
! style="width=25% font-size:9pt "|Application Scope | ! style="width=25% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
Line 67: | Line 67: | ||
|} | |} | ||
− | === | + | ===Molecular Types=== |
*mRNA | *mRNA | ||
+ | |||
===Evaluation Methods=== | ===Evaluation Methods=== | ||
* [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
Line 78: | Line 79: | ||
*'''Email''': zjxiawei@gmail.com | *'''Email''': zjxiawei@gmail.com | ||
*'''Institution''': Hainan Key Laboratory of Tropical Oil Crops Biology/Coconuts Research Institute, Chinese Academy of Tropical Agricultural Sciences, Wenchang, Hainan 571339, PR China | *'''Institution''': Hainan Key Laboratory of Tropical Oil Crops Biology/Coconuts Research Institute, Chinese Academy of Tropical Agricultural Sciences, Wenchang, Hainan 571339, PR China | ||
+ | |||
+ | ===Citation Statistics=== | ||
+ | Cited by [https://scholar.google.com/scholar?cites=14530537738325857795&as_sdt=2005&sciodt=0,5&hl=en '''13'''] (Based on Google Scholar [2017-09-01]) | ||
+ | |||
+ | =='''''Tissue Culture'''''== | ||
+ | |||
+ | ===Internal Control Genes=== | ||
+ | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
+ | |- | ||
+ | ! Gene Symbol | ||
+ | ! Gene Name | ||
+ | ! style="width=25% font-size:9pt "|Application Scope | ||
+ | ! Accession Number | ||
+ | ! Primer | ||
+ | ! Size [bp] | ||
+ | ! Tm [℃] | ||
+ | ! Detection | ||
+ | |- | ||
+ | |align="center"| PD00380<ref name="ref2"/> | ||
+ | |align="center"| Predicted 40S ribosomal protein S27-2 | ||
+ | | | ||
+ | *Tissue Culture | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/EY397675 '''EY397675'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:GATGGTTCTTCCGAACGATATTGA | ||
+ | * R:TCACATCCATGAAGAATGAGTTCG | ||
+ | |align="center"| 113 | ||
+ | |align="center"| 63 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| PD00569<ref name="ref2"/> | ||
+ | |align="center"| Manganese superoxide dismutase | ||
+ | | | ||
+ | *Tissue Culture | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nucest/EL682210 '''EL682210'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CACCACCAGACGTACATCACAAA | ||
+ | * R:GATATGACCTCCGCCATTGAACT | ||
+ | |align="center"| 129 | ||
+ | |align="center"| 60 | ||
+ | |align="center"| SYBR | ||
+ | |} | ||
+ | |||
+ | ===Molecular Types=== | ||
+ | * mRNA | ||
+ | |||
+ | ===Evaluation Methods=== | ||
+ | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
+ | * [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference'''] | ||
+ | * [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference'''] | ||
+ | ===Contact=== | ||
+ | *'''Name''': Pek-Lan Chan | ||
+ | *'''Email''': chanpl@mpob.gov.my | ||
+ | *'''Institution''': Advanced Biotechnology and Breeding Centre, Malaysian Palm Oil Board (MPOB), No. 6, Persiaran Institusi, Bandar Baru Bangi, Kajang, Selangor, Malaysia | ||
+ | ===Citation Statistics=== | ||
+ | Cited by [https://scholar.google.com/scholar?cites=9502973521388377307&as_sdt=2005&sciodt=0,5&hl=en '''13'''] (Based on Google Scholar [2017-09-01]) | ||
=='''References'''== | =='''References'''== | ||
Line 85: | Line 142: | ||
</ref> | </ref> | ||
<ref name="ref2"> | <ref name="ref2"> | ||
+ | Chan P L, Rose R J, Murad A M A, et al. Evaluation of reference genes for quantitative real-time PCR in oil palm elite planting materials propagated by tissue culture[J]. PloS one, 2014, 9(6): e99774. | ||
+ | </ref> | ||
+ | <ref name="ref3"> | ||
Teo SH, Rashid U, Choong SYT, Taufiq-Yap YH (2017) Heterogeneous calcium-based bimetallic oxide catalyzed transesterification of Elaeis guineensis derived triglycerides for biodiesel production. Energy Conversion and Management 141, 20-27 | Teo SH, Rashid U, Choong SYT, Taufiq-Yap YH (2017) Heterogeneous calcium-based bimetallic oxide catalyzed transesterification of Elaeis guineensis derived triglycerides for biodiesel production. Energy Conversion and Management 141, 20-27 | ||
</ref> | </ref> | ||
</references> | </references> | ||
+ | =='''Categories'''== | ||
+ | [[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]] | ||
+ | [[Category:APT]] [[Category:Cyclophilin]] [[Category:eIF]] [[Category:eIF]] | ||
+ | [[Category:Salinity Treatment]] [[Category:Abiotic Stress]] [[Category:Different Developmental Stages]] [[Category:Tissue Culture]] [[Category:Drought Treatment]] [[Category:Cold Treatment]] | ||
+ | |||
+ | [[Category:geNorm]] | ||
+ | [[Category:NormFinder]] | ||
+ | [[Category:BestKeeper]] |
Latest revision as of 09:49, 1 September 2017
Contents
Description
- Elaeis guineensis belongs to genus Elaeis in the family Arecaceae (Palmaceae). It a highly productive oil-bearing crop that is mainly grown in tropical and subtropical regions, accounting for 33% of vegetable oil and 45% of edible oil produced worldwide. It has a long productive life span and grows well in low land with humid places and tropical perennial plants can be cultivated easily in Malaysia. However, it is frequently exposed to soil and atmospheric drought and other stresses[1][2][3].
- Common Name: African oil palm, Macaw-fat
- NCBI Taxonomy
Abiotic Stress
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
eIF1[1] | Eukaryotic initiation factor 4A |
|
GAJH01031684.1 |
|
97 | 85.3 ± 0.18 | SYBR |
eIF2[1] | Eukaryotic initiation factor 4A |
|
GAJH01015579.1 |
|
106 | 81.72 ± 0.16 | SYBR |
APT[1] | Adenine phosphoribosyltransferase |
|
GAJH01036635.1 |
|
102 | 82.34 ± 0.14 | SYBR |
cyc[1] | Cyclophilin |
|
GAJH01023806.1 |
|
94 | 82.88 ± 0.14 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Wei Xia
- Email: zjxiawei@gmail.com
- Institution: Hainan Key Laboratory of Tropical Oil Crops Biology/Coconuts Research Institute, Chinese Academy of Tropical Agricultural Sciences, Wenchang, Hainan 571339, PR China
Citation Statistics
Cited by 13 (Based on Google Scholar [2017-09-01])
Tissue Culture
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
PD00380[2] | Predicted 40S ribosomal protein S27-2 |
|
EY397675 |
|
113 | 63 | SYBR |
PD00569[2] | Manganese superoxide dismutase |
|
EL682210 |
|
129 | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Pek-Lan Chan
- Email: chanpl@mpob.gov.my
- Institution: Advanced Biotechnology and Breeding Centre, Malaysian Palm Oil Board (MPOB), No. 6, Persiaran Institusi, Bandar Baru Bangi, Kajang, Selangor, Malaysia
Citation Statistics
Cited by 13 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 1.2 1.3 1.4 Xia W, Mason AS, Xiao Y, et al. (2014) Analysis of multiple transcriptomes of the African oil palm (Elaeis guineensis) to identify reference genes for RT-qPCR. J Biotechnol 184, 63-73.
- ↑ 2.0 2.1 2.2 Chan P L, Rose R J, Murad A M A, et al. Evaluation of reference genes for quantitative real-time PCR in oil palm elite planting materials propagated by tissue culture[J]. PloS one, 2014, 9(6): e99774.
- ↑ Teo SH, Rashid U, Choong SYT, Taufiq-Yap YH (2017) Heterogeneous calcium-based bimetallic oxide catalyzed transesterification of Elaeis guineensis derived triglycerides for biodiesel production. Energy Conversion and Management 141, 20-27