Difference between revisions of "Eremosparton songoricum"

From ICG
Jump to navigation Jump to search
Line 19: Line 19:
 
|-
 
|-
 
|align="center"| EF<ref name="ref1"/>
 
|align="center"| EF<ref name="ref1"/>
|align="center"| elongation factor 1-alpha
+
|align="center"| Elongation factor 1-alpha
 
|
 
|
 
* Various stress conditions
 
* Various stress conditions
Line 32: Line 32:
 
|-
 
|-
 
|align="center"| TUB<ref name="ref1"/>
 
|align="center"| TUB<ref name="ref1"/>
|align="center"| alpha-tubulin  
+
|align="center"| Alpha-tubulin  
 
|
 
|
 
* Various stress conditions
 
* Various stress conditions
Line 44: Line 44:
 
|-
 
|-
 
|align="center"| ACT<ref name="ref1"/>
 
|align="center"| ACT<ref name="ref1"/>
|align="center"| actin
+
|align="center"| Actin
 
|
 
|
 
* Differing germination stages
 
* Differing germination stages
Line 56: Line 56:
 
|-
 
|-
 
|align="center"| GAPDH<ref name="ref1"/>
 
|align="center"| GAPDH<ref name="ref1"/>
|align="center"| glyceraldehyde-3-phosphate dehydrogenase  
+
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase  
 
|
 
|
 
* Multiple adult tissue samples
 
* Multiple adult tissue samples
Line 68: Line 68:
 
|-
 
|-
 
|align="center"| UBQ<ref name="ref1"/>
 
|align="center"| UBQ<ref name="ref1"/>
|align="center"| ubiquitin
+
|align="center"| Ubiquitin
 
|
 
|
 
* Multiple adult tissue samples
 
* Multiple adult tissue samples

Revision as of 15:32, 22 June 2017

Description

Eremosparton songoricum-1.jpg
  • The drought-tolerant plant Eremosparton songoricum (Litv.) Vass. is a leafless perennial clone-forming semi-shrub. E. songoricum is a rare endemic plant of central Asia and is the only species of the genus in China, where it is found only in the Gurbantunggut desert (Xinjiang, China. As a rare and extremely drought-tolerant Leguminosae shrub, E. songoricum is being developed as a model organism for investigating the morphological, biochemical, physiological and molecular adaptations and responses to water deficit.
  • The ability to identify and compare the expression profiles of key genes involved in these mechanisms would provide a powerful tool for evaluating the molecular changes in plants adapted to the desert environment[1] [2].

Different Tissues & Abiotic Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF[1] Elongation factor 1-alpha
  • Various stress conditions
  • Differing germination stages
JN866817
  • F:CGGACATCGTGACTTTATC
  • R:TGTGGTGGCATCCATCTT
199 82.5 SYBR
TUB[1] Alpha-tubulin
  • Various stress conditions
JN866820
  • F:TAGCAGCGTCTTCCTTT
  • R:ATGGTTTGATGCCGAGT
204 82 SYBR
ACT[1] Actin
  • Differing germination stages
JN866816
  • F:AGGAACCACCGATCCAGACA
  • R:GGTGCCCTGAGGTCCTGTT
275 83 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Multiple adult tissue samples
JN866814
  • F:AATGTCTTTCCGTGTCC
  • R:TCCTCTTCAATGTAACCC
150 81 SYBR
UBQ[1] Ubiquitin
  • Multiple adult tissue samples
JN866815
  • F:TGGTCGCACCTTAGCCG
  • R:TCCCTCCTTATCTTGAATCTTGG
178 82 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xiao-Shuang Li
  • Email: xiaoshuangliok@sina.com
  • Institute: Key Laboratory of Biogeography and Bioresource in Arid Land, Xinjiang Institute of Ecology and Geography, Chinese Academy of Sciences, Urumqi 830011, China

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Li X S, Yang H L, Zhang D Y, et al. Reference gene selection in the desert plant Eremosparton songoricum[J]. International journal of molecular sciences, 2012, 13(6): 6944-6963.
  2. Jian, B.; Liu, B.; Bi, Y.R.; Hou, W.S.; Wu, C.X.; Han, T.F. Validation of internal control for gene expression study in soybean by quantitative real-time PCR. BMC Mol. Biol. 2008, 9, doi:10.1186/1471-2199-9-59.