Difference between revisions of "Eucalyptus globulus"

From ICG
Jump to navigation Jump to search
(13 intermediate revisions by 7 users not shown)
Line 1: Line 1:
[[File:Eucalyptus globulus.png|right|200px|link=Eucalyptus globulus]]
[[File:Eucalyptus globulus-1.jpg|right|327px|]]
* '''''Eucalyptus globulus''''' is one of the hardwood species growing in Europe with the best mechanical properties and great natural durability. ''Eucalyptus globulus'' from Galicia (Spain) also exhibits good natural durability comparable to that of chestnut and oak, making it suitable for outdoor applications. Currently several companies together with the University of Santiago de Compostela are carrying out research projects to develop high performance structural applications using ''Eucalyptus globulus'' for both indoor and outdoor uses and improve the drying process<ref name="ref1"/><ref name="ref2"/>.
* Eucalyptus globulus is one of the hardwood species growing in Europe with the best mechanical properties and great natural durability.
* <font color=blue>'''Common Name:'''</font> '''Blue gum'''
* Together with beech and ash, Eucalyptus globulus is one of the hardwood species growing in Europe with higher mechanical performance. In addition, Eucalyptus globulus from Galicia (Spain) also exhibits good natural durability comparable to that of chestnut and oak, making it suitable for outdoor applications.  
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=34317 <font color=blue>'''NCBI Taxonomy'''</font>]
* Currently several companies together with the University of Santiago de Compostela are carrying out research projects to develop high performance structural applications using Eucalyptus globulus for both indoor and outdoor uses and improve the drying process<ref name="ref1"/><ref name="ref2"/>.
=='''''Cold Acclimation'''''==
=='''''Cold Acclimation'''''==
===Reference Genes===
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
{|class="wikitable sortable" style="font-size:10pt; width:100%"
Line 25: Line 24:
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/BF707484 '''BF707484''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/BF707484 '''BF707484''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
* F:gacggacaggaacaagtatgagac
* R:ccctccacggaataatgatcgc
|align="center"| 93
|align="center"| 93
|align="center"| 60
|align="center"| 60
Line 37: Line 36:
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/ES596892 '''ES596892''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/ES596892 '''ES596892''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
* F:ggaagatgctgccaacaactttgc
* R:aaccagtgcctccaccaacag
|align="center"| 152
|align="center"| 152
|align="center"| 60
|align="center"| 60
Line 49: Line 48:
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/CB009726 '''CB009726''']  
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/CB009726 '''CB009726''']  
|nowrap style="font-size:9pt"|
|nowrap style="font-size:9pt"|
* F:cctgtccttgaattgtcacacttcc
* R:ccattccagcatcaccgttcttc
|align="center"| 131
|align="center"| 131
|align="center"| 60
|align="center"| 60
Line 56: Line 55:
===Moleculer Type===
===Molecular Types===
* mRNA
* mRNA
===Evaluation Methods===
===Evaluation Methods===
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 65: Line 65:
*'''Institution''': Faculty of Forest Sciences, University of Concepcio´n, Concepcio´n, Chile
*'''Institution''': Faculty of Forest Sciences, University of Concepcio´n, Concepcio´n, Chile
===Citation Statistics===
===Citation Statistics===
Cited by '''21''' (Based on Google Scholar [2017-06-16])
Cited by [https://scholar.google.com/scholar?cites=214421229150413533&as_sdt=2005&sciodt=0,5&hl=en'''22'''] (Based on Google Scholar [2017-09-01])
Line 76: Line 76:
[[Category:Plants]] [[Category:mRNA]] 
[[Category:Plants]] [[Category:mRNA]][[Category:SYBR]][[Category:EF1α]] [[Category:Ubiquitin]] [[Category:Ubiquitin]]
[[Category:EF1α]] [[Category:Ubiquitin]] [[Category:Ubiquitin]]
[[Category:Cold Treatment]]
[[Category:Cold Treatment]]

Latest revision as of 06:41, 1 September 2017


Eucalyptus globulus.png
  • Eucalyptus globulus is one of the hardwood species growing in Europe with the best mechanical properties and great natural durability. Eucalyptus globulus from Galicia (Spain) also exhibits good natural durability comparable to that of chestnut and oak, making it suitable for outdoor applications. Currently several companies together with the University of Santiago de Compostela are carrying out research projects to develop high performance structural applications using Eucalyptus globulus for both indoor and outdoor uses and improve the drying process[1][2].
  • Common Name: Blue gum
  • NCBI Taxonomy

Cold Acclimation

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
UBC[1] Ubiquitin C
  • Acclimation and de-acclimation treatments
93 60 SYBR
α-TUB[1] α-Tubulin
  • Acclimation and de-acclimation treatments
152 60 SYBR
EF1α[1] Elongation factor 1α
  • Acclimation and de-acclimation treatments
131 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods


  • Name: Sofia Valenzuela
  • Email: sofvalen@udec.cl
  • Institution: Faculty of Forest Sciences, University of Concepcio´n, Concepcio´n, Chile

Citation Statistics

Cited by 22 (Based on Google Scholar [2017-09-01])


  1. 1.0 1.1 1.2 1.3 Fernández M, Villarroel C, Balbontín C, et al. Validation of reference genes for real-time qRT-PCR normalization during cold acclimation in Eucalyptus globulus[J]. Trees, 2010, 24(6): 1109-1116.
  2. Lara-Bocanegra A J, Majano-Majano A, Crespo J, et al. Finger-jointed Eucalyptus globulus with 1C-PUR adhesive for high performance engineered laminated products[J]. Construction and Building Materials, 2017, 135: 529-537.
