Eucalyptus globulus

Description

Eucalyptus globulus is one of the hardwood species growing in Europe with the best mechanical properties and great natural durability. Eucalyptus globulus from Galicia (Spain) also exhibits good natural durability comparable to that of chestnut and oak, making it suitable for outdoor applications. Currently several companies together with the University of Santiago de Compostela are carrying out research projects to develop high performance structural applications using Eucalyptus globulus for both indoor and outdoor uses and improve the drying process^[1]^[2].
Common Name: Blue gum
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
UBC^[1]	Ubiquitin C	Acclimation and de-acclimation treatments	BF707484	F:GAVGGACAGGAACAAGTATGAGAC R:CCCTCCACGGAATAATGATCGC	93	60	SYBR
α-TUB^[1]	α-Tubulin	Acclimation and de-acclimation treatments	ES596892	F:GGAAGATGCTGCCAACAACTTTGC R:AACCAGTGCCTCCACCAACAG	152	60	SYBR
EF1α^[1]	Elongation factor 1α	Acclimation and de-acclimation treatments	CB009726	F:CCTGTCCTTGAATTGTCACACTTCC R:CCATTCCAGCATCACCGTTCTTC	131	60	SYBR

Name: Sofia Valenzuela
Email: sofvalen@udec.cl
Institution: Faculty of Forest Sciences, University of Concepcio´n, Concepcio´n, Chile

Cited by 22 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Fernández M, Villarroel C, Balbontín C, et al. Validation of reference genes for real-time qRT-PCR normalization during cold acclimation in Eucalyptus globulus[J]. Trees, 2010, 24(6): 1109-1116.
↑ Lara-Bocanegra A J, Majano-Majano A, Crespo J, et al. Finger-jointed Eucalyptus globulus with 1C-PUR adhesive for high performance engineered laminated products[J]. Construction and Building Materials, 2017, 135: 529-537.