Difference between revisions of "Eucalyptus grandis"

From ICG
Jump to navigation Jump to search
 
(13 intermediate revisions by 7 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
+
[[File:Eucalyptus grandis.png|right|200px|link=Eucalyptus grandis]]
[[File:Eucalyptus grandis-1.jpg|right|127px|]]
+
*'''''Eucalyptus grandis''''' is one of the most cultivated for industrial purposes, particularly in South Africa and Brazil. Most of the current Eucalyptus production in Brazil is cultivated in an area over 5.4 million hectares. Given its fast growing rates and coppicing ability, eucalyptus has also been identified as a potential feedstock for biofuels. Besides, bark is also a source of nutrients, carbon as well as being used to form a protective covering of soils in commercial plantations<ref name="ref1"/> <ref name="ref2"/> .
* Among the multitude of species, Eucalyptus grandis (Hill ex Maiden) is one of the most cultivated for industrial purposes, particularly in South Africa and Brazil.
+
* <font color=blue>'''Common Name:'''</font> '''Fflooded gum''', '''Gum'''
* Samples of Eucalyptus urograndis and Eucalyptus grandis sawdust were autohydrolyzed in aqueous conditions to reach temperatures in the range 110–190 °C and reaction times of 0–150 min in a minireactor.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=71139 <font color=blue>'''NCBI Taxonomy'''</font>]
* Most of the current Eucalyptus production in Brazil is cultivated in an area over 5.4 million hectares [1]. Given its fast growing rates and coppicing ability, eucalyptus has also been identified as a potential feedstock for biofuels. Besides, bark is also a source of nutrients, carbon as well as being used to form a protective covering of soils in commercial plantations<ref name="ref1"/> <ref name="ref2"/> .
 
  
 
=='''''In Vitro Adventitious Rooting'''''==
 
=='''''In Vitro Adventitious Rooting'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 14: Line 13:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 44: Line 43:
 
|}
 
|}
  
===Moleculer Type===
+
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 54: Line 54:
 
*'''Institution''': Center for Biotechnology, Federal University of Rio Grande do Sul, P.O. Box 15005, 91501-970 Porto Alegre, RS, Brazil
 
*'''Institution''': Center for Biotechnology, Federal University of Rio Grande do Sul, P.O. Box 15005, 91501-970 Porto Alegre, RS, Brazil
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''49''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=10022781139742184755&as_sdt=2005&sciodt=0,5&hl=en'''50'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 65: Line 65:
 
</ref>
 
</ref>
 
</references>
 
</references>
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]]
+
=='''Categories'''==
[[Category:18S rRNA]] [[Category:Ubiquitin]]
+
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:18S rRNA]][[Category:Ubiquitin]][[Category:Hormone Treatment]][[Category:Specific Tissue]][[Category:geNorm]][[Category:NormFinder]]

Latest revision as of 06:40, 1 September 2017

Description

Eucalyptus grandis.png
  • Eucalyptus grandis is one of the most cultivated for industrial purposes, particularly in South Africa and Brazil. Most of the current Eucalyptus production in Brazil is cultivated in an area over 5.4 million hectares. Given its fast growing rates and coppicing ability, eucalyptus has also been identified as a potential feedstock for biofuels. Besides, bark is also a source of nutrients, carbon as well as being used to form a protective covering of soils in commercial plantations[1] [2] .
  • Common Name: Fflooded gum, Gum
  • NCBI Taxonomy

In Vitro Adventitious Rooting

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
UBI[1] Polyubiquitin
  • Microccuttings rooted in vitro, in presence or absence of auxin
HO048245
  • F:AGAAGGAATCGACCCTCCAC
  • R:CCTTGACGTTGTCAATGGTG
126 60 SYBR
18S[1] RNA ribosomal 18S
  • Microccuttings rooted in vitro, in presence or absence of auxin
HO048251
  • F:TGACGGAGAATTAGGGTTCG
  • R:CCGTGTCAGGATTGGGTAAT
100 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Arthur G Fett-Neto
  • Email: fettneto@cbiot.ufrgs.br
  • Institution: Center for Biotechnology, Federal University of Rio Grande do Sul, P.O. Box 15005, 91501-970 Porto Alegre, RS, Brazil

Citation Statistics

Cited by 50 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 de Almeida M R, Ruedell C M, Ricachenevsky F K, et al. Reference gene selection for quantitative reverse transcription-polymerase chain reaction normalization during in vitro adventitious rooting in Eucalyptus globulus Labill[J]. BMC molecular biology, 2010, 11(1): 73.
  2. Budzinski I G F, Moon D H, Morosini J S, et al. Integrated analysis of gene expression from carbon metabolism, proteome and metabolome, reveals altered primary metabolism in Eucalyptus grandis bark, in response to seasonal variation[J]. BMC Plant Biology, 2016, 16(1): 149.

Categories