Eucalyptus grandis

From ICG
Jump to navigation Jump to search

Description

Eucalyptus grandis-1.jpg
  • Among the multitude of species, Eucalyptus grandis (Hill ex Maiden) is one of the most cultivated for industrial purposes, particularly in South Africa and Brazil.
  • Samples of Eucalyptus urograndis and Eucalyptus grandis sawdust were autohydrolyzed in aqueous conditions to reach temperatures in the range 110–190 °C and reaction times of 0–150 min in a minireactor.
  • Most of the current Eucalyptus production in Brazil is cultivated in an area over 5.4 million hectares [1]. Given its fast growing rates and coppicing ability, eucalyptus has also been identified as a potential feedstock for biofuels. Besides, bark is also a source of nutrients, carbon as well as being used to form a protective covering of soils in commercial plantations[1] [2] .

In Vitro Adventitious Rooting

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
UBI[1] Polyubiquitin
  • Microccuttings rooted in vitro, in presence or absence of auxin
HO048245
  • F:AGAAGGAATCGACCCTCCAC
  • R:CCTTGACGTTGTCAATGGTG
126 60 SYBR
18S[1] RNA ribosomal 18S
  • Microccuttings rooted in vitro, in presence or absence of auxin
HO048251
  • F:TGACGGAGAATTAGGGTTCG
  • R:CCGTGTCAGGATTGGGTAAT
100 60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Arthur G Fett-Neto
  • Email: fettneto@cbiot.ufrgs.br
  • Institution: Center for Biotechnology, Federal University of Rio Grande do Sul, P.O. Box 15005, 91501-970 Porto Alegre, RS, Brazil

Citation Statistics

Cited by 49 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 de Almeida M R, Ruedell C M, Ricachenevsky F K, et al. Reference gene selection for quantitative reverse transcription-polymerase chain reaction normalization during in vitro adventitious rooting in Eucalyptus globulus Labill[J]. BMC molecular biology, 2010, 11(1): 73.
  2. Budzinski I G F, Moon D H, Morosini J S, et al. Integrated analysis of gene expression from carbon metabolism, proteome and metabolome, reveals altered primary metabolism in Eucalyptus grandis bark, in response to seasonal variation[J]. BMC Plant Biology, 2016, 16(1): 149.