Difference between revisions of "Fagopyrum esculentum"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
[[File:REFqPCRFagopyrumesculentum.jpg|right|227px|]]
 
[[File:REFqPCRFagopyrumesculentum.jpg|right|227px|]]
*Buckwheat (Fagopyrum esculentum). Buckwheat is an important grain and honey crop widely cultivated in several countries (Canada, China, Japan, Russia and Ukraine).  
+
*Fagopyrum esculentum (Buckwheat) is an important grain and honey crop widely cultivated in several countries (Canada, China, Japan, Russia and Ukraine). Its seeds are used as whole grain, groats and flour. Because of similar usage, buckwheat is usually classified as cereal. However, phylogenetically it is far from true cereals - members of the monocot family Poaceae.  
*Its seeds are used as whole grain, groats and flour. Because of similar usage, buckwheat is usually classified as cereal. However, phylogenetically it is far from true cereals - members of the monocot family Poaceae.  
 
 
*Buckwheat belongs to the family Polygonaceae from the order Caryophyllales - the group of flowering plants which is distant from any model plant species.
 
*Buckwheat belongs to the family Polygonaceae from the order Caryophyllales - the group of flowering plants which is distant from any model plant species.
  

Revision as of 06:45, 22 June 2017

Description

REFqPCRFagopyrumesculentum.jpg
  • Fagopyrum esculentum (Buckwheat) is an important grain and honey crop widely cultivated in several countries (Canada, China, Japan, Russia and Ukraine). Its seeds are used as whole grain, groats and flour. Because of similar usage, buckwheat is usually classified as cereal. However, phylogenetically it is far from true cereals - members of the monocot family Poaceae.
  • Buckwheat belongs to the family Polygonaceae from the order Caryophyllales - the group of flowering plants which is distant from any model plant species.

Different Plant Structures

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Expressed1[1][2] expressed protein of unknown function
  • Development stage
JF343809
  • F:AGGCCAGTTCCTGCTGAATGTAATGC
  • R:TAGCCTGATCCAAACAAGCCTGGCAA
127 60 SYBR
SAND[1] SAND family protein
  • Development stage
JF343810
  • F:GACCCCCTTGCAGACAAAGCATTGGCA
  • R:TCTCGTTCTCAACGTCTTTTACCCACTGG
125 60 SYBR
CACS[1] clathrin adapter complex subunit family protein
  • Development stage
JF343811
  • F:AAGACAGTCAGTTTCGTGCCACCTGA
  • R:TCCATGCGTGTTCTACCCAACTCCTT
79 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Natalia V. Demidenko
  • Email: alekseypenin@gmail.com
  • Institute: Department of Genetics, Biological Faculty, M.V. Lomonosov Moscow State University, Moscow, Russia

Citation Statistics

Cited by 74 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Demidenko N V, Logacheva M D, Penin A A. Selection and validation of reference genes for quantitative real-time PCR in buckwheat (Fagopyrum esculentum) based on transcriptome sequence data[J]. PLoS One, 2011, 6(5): e19434.
  2. Demidenko NV1, Logacheva MD, Penin AA. Selection and validation of reference genes for quantitative real-time PCR in buckwheat (Fagopyrum esculentum) based on transcriptome sequence data. PLoS One. 2011 May 12;6(5):e19434. doi: 10.1371/journal.pone.0019434.