Difference between revisions of "Fagopyrum esculentum"

From ICG
Jump to navigation Jump to search
(Created page with "=='''Description'''== =='''Different Plant Structures'''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene symbol ! Gene nam...")
 
Line 5: Line 5:
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
! Gene symbol  
+
! Gene Symbol  
! Gene name
+
! Gene Name
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
Line 51: Line 51:
 
|}
 
|}
  
===Moleculer types===
+
===Moleculer Types===
 
* mRNA
 
* mRNA
  
Line 63: Line 63:
 
*'''Email''':  alekseypenin@gmail.com
 
*'''Email''':  alekseypenin@gmail.com
 
*'''Institute''':  Department of Genetics, Biological Faculty, M.V. Lomonosov Moscow State University, Moscow, Russia
 
*'''Institute''':  Department of Genetics, Biological Faculty, M.V. Lomonosov Moscow State University, Moscow, Russia
 +
===Citation Statistics===
 +
Cited by '''74''' (Based on Google Scholar [2017-06-16])
  
 
=='''References'''==
 
=='''References'''==

Revision as of 10:16, 16 June 2017

Description

Different Plant Structures

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Expressed1[1] expressed protein of unknown function
  • development stage
JF343809
  • F:AGGCCAGTTCCTGCTGAATGTAATGC
  • R:TAGCCTGATCCAAACAAGCCTGGCAA
127 60 SYBR
SAND[1] SAND family protein
  • development stage
JF343810
  • F:GACCCCCTTGCAGACAAAGCATTGGCA
  • R:TCTCGTTCTCAACGTCTTTTACCCACTGG
125 60 SYBR
CACS[1] clathrin adapter complex subunit family protein
  • development stage
JF343811
  • F:AAGACAGTCAGTTTCGTGCCACCTGA
  • R:TCCATGCGTGTTCTACCCAACTCCTT
79 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Natalia V. Demidenko
  • Email: alekseypenin@gmail.com
  • Institute: Department of Genetics, Biological Faculty, M.V. Lomonosov Moscow State University, Moscow, Russia

Citation Statistics

Cited by 74 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Demidenko N V, Logacheva M D, Penin A A. Selection and validation of reference genes for quantitative real-time PCR in buckwheat (Fagopyrum esculentum) based on transcriptome sequence data[J]. PLoS One, 2011, 6(5): e19434.