Difference between revisions of "Fagopyrum esculentum"

From ICG
Jump to navigation Jump to search
 
(23 intermediate revisions by 7 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
[[File:REFqPCRFagopyrumesculentum.jpg|right|227px|]]
+
[[File:Fagopyrum esculentum.png|right|200px|link=Fagopyrum esculentum]]
*Buckwheat (Fagopyrum esculentum). Buckwheat is an important grain and honey crop widely cultivated in several countries (Canada, China, Japan, Russia and Ukraine).  
+
*'''''Fagopyrum esculentum''''' belongs to the family Polygonaceae from the order Caryophyllales, the group of flowering plants which is distant from any model plant species. It is an important grain and honey crop widely cultivated in several countries (Canada, China, Japan, Russia and Ukraine). Its seeds are used as whole grain, groats and flour<ref name="ref1"/>.
*Its seeds are used as whole grain, groats and flour. Because of similar usage, buckwheat is usually classified as cereal. However, phylogenetically it is far from true cereals - members of the monocot family Poaceae.  
+
* <font color=blue>'''Common Name:'''</font> '''Buckwheat'''
*Buckwheat belongs to the family Polygonaceae from the order Caryophyllales - the group of flowering plants which is distant from any model plant species.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3617 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''Different Plant Structures'''==
 
=='''Different Plant Structures'''==
  
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 14: Line 14:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
 
! Detection
 
! Detection
 
|-
 
|-
|align="center"| Expressed1<ref name="ref1"/><ref name="ref2"/>
+
|align="center"| Expressed1<ref name="ref1"/>
|align="center"| expressed protein of unknown function
+
|align="center"| Expressed protein of unknown function
 
|
 
|
 
* Development stage
 
* Development stage
Line 44: Line 44:
 
|-
 
|-
 
|align="center"| CACS<ref name="ref1"/>
 
|align="center"| CACS<ref name="ref1"/>
|align="center"| clathrin adapter complex subunit family protein
+
|align="center"| Clathrin adapter complex subunit family protein
 
|
 
|
 
* Development stage
 
* Development stage
Line 56: Line 56:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 67: Line 67:
 
*'''Name''': Natalia V. Demidenko
 
*'''Name''': Natalia V. Demidenko
 
*'''Email''':  alekseypenin@gmail.com
 
*'''Email''':  alekseypenin@gmail.com
*'''Institute''':  Department of Genetics, Biological Faculty, M.V. Lomonosov Moscow State University, Moscow, Russia
+
*'''Institution''':  Department of Genetics, Biological Faculty, M.V. Lomonosov Moscow State University, Moscow, Russia
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''74''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=2184471066058185585&as_sdt=2005&sciodt=0,5&hl=en'''76'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 75: Line 76:
 
<ref name="ref1">
 
<ref name="ref1">
 
Demidenko N V, Logacheva M D, Penin A A. Selection and validation of reference genes for quantitative real-time PCR in buckwheat (Fagopyrum esculentum) based on transcriptome sequence data[J]. PLoS One, 2011, 6(5): e19434.
 
Demidenko N V, Logacheva M D, Penin A A. Selection and validation of reference genes for quantitative real-time PCR in buckwheat (Fagopyrum esculentum) based on transcriptome sequence data[J]. PLoS One, 2011, 6(5): e19434.
</ref>
 
<ref name="ref2">
 
Demidenko NV1, Logacheva MD, Penin AA. Selection and validation of reference genes for quantitative real-time PCR in buckwheat (Fagopyrum esculentum) based on transcriptome sequence data. PLoS One. 2011 May 12;6(5):e19434. doi: 10.1371/journal.pone.0019434.
 
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 
[[Category:Plants]]
 
[[Category:Plants]]
[[Category:mRNA]] 
+
[[Category:mRNA]][[Category:SYBR]]
[[Category:SYBR]]
+
[[Category:CACS]] [[Category:EP]] [[Category:SAND]]
 +
[[Category:Different Plant Structures]]
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]

Latest revision as of 06:40, 1 September 2017

Description

Fagopyrum esculentum.png
  • Fagopyrum esculentum belongs to the family Polygonaceae from the order Caryophyllales, the group of flowering plants which is distant from any model plant species. It is an important grain and honey crop widely cultivated in several countries (Canada, China, Japan, Russia and Ukraine). Its seeds are used as whole grain, groats and flour[1].
  • Common Name: Buckwheat
  • NCBI Taxonomy

Different Plant Structures

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Expressed1[1] Expressed protein of unknown function
  • Development stage
JF343809
  • F:AGGCCAGTTCCTGCTGAATGTAATGC
  • R:TAGCCTGATCCAAACAAGCCTGGCAA
127 60 SYBR
SAND[1] SAND family protein
  • Development stage
JF343810
  • F:GACCCCCTTGCAGACAAAGCATTGGCA
  • R:TCTCGTTCTCAACGTCTTTTACCCACTGG
125 60 SYBR
CACS[1] Clathrin adapter complex subunit family protein
  • Development stage
JF343811
  • F:AAGACAGTCAGTTTCGTGCCACCTGA
  • R:TCCATGCGTGTTCTACCCAACTCCTT
79 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Natalia V. Demidenko
  • Email: alekseypenin@gmail.com
  • Institution: Department of Genetics, Biological Faculty, M.V. Lomonosov Moscow State University, Moscow, Russia

Citation Statistics

Cited by 76 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Demidenko N V, Logacheva M D, Penin A A. Selection and validation of reference genes for quantitative real-time PCR in buckwheat (Fagopyrum esculentum) based on transcriptome sequence data[J]. PLoS One, 2011, 6(5): e19434.

Categories