Difference between revisions of "Fagopyrum esculentum"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
[[File:REFqPCRFagopyrumesculentum.jpg|right|227px|]]
+
[[File:Fagopyrum esculentum.png|right|200px|link=Fagopyrum esculentum]]
 
*'''''Fagopyrum esculentum''''' belongs to the family Polygonaceae from the order Caryophyllales, the group of flowering plants which is distant from any model plant species. It is an important grain and honey crop widely cultivated in several countries (Canada, China, Japan, Russia and Ukraine). Its seeds are used as whole grain, groats and flour.
 
*'''''Fagopyrum esculentum''''' belongs to the family Polygonaceae from the order Caryophyllales, the group of flowering plants which is distant from any model plant species. It is an important grain and honey crop widely cultivated in several countries (Canada, China, Japan, Russia and Ukraine). Its seeds are used as whole grain, groats and flour.
 
* <font color=blue>'''Common Name:'''</font> '''Buckwheat'''
 
* <font color=blue>'''Common Name:'''</font> '''Buckwheat'''

Revision as of 02:48, 29 June 2017

Description

Fagopyrum esculentum.png
  • Fagopyrum esculentum belongs to the family Polygonaceae from the order Caryophyllales, the group of flowering plants which is distant from any model plant species. It is an important grain and honey crop widely cultivated in several countries (Canada, China, Japan, Russia and Ukraine). Its seeds are used as whole grain, groats and flour.
  • Common Name: Buckwheat
  • NCBI Taxonomy

Different Plant Structures

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Expressed1[1] Expressed protein of unknown function
  • Development stage
JF343809
  • F:AGGCCAGTTCCTGCTGAATGTAATGC
  • R:TAGCCTGATCCAAACAAGCCTGGCAA
127 60 SYBR
SAND[1] SAND family protein
  • Development stage
JF343810
  • F:GACCCCCTTGCAGACAAAGCATTGGCA
  • R:TCTCGTTCTCAACGTCTTTTACCCACTGG
125 60 SYBR
CACS[1] Clathrin adapter complex subunit family protein
  • Development stage
JF343811
  • F:AAGACAGTCAGTTTCGTGCCACCTGA
  • R:TCCATGCGTGTTCTACCCAACTCCTT
79 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Natalia V. Demidenko
  • Email: alekseypenin@gmail.com
  • Institution: Department of Genetics, Biological Faculty, M.V. Lomonosov Moscow State University, Moscow, Russia

Citation Statistics

Cited by 74 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Demidenko N V, Logacheva M D, Penin A A. Selection and validation of reference genes for quantitative real-time PCR in buckwheat (Fagopyrum esculentum) based on transcriptome sequence data[J]. PLoS One, 2011, 6(5): e19434.