Fagopyrum esculentum

From ICG
Revision as of 12:49, 15 June 2017 by ICG Expert1 (talk | contribs) (Created page with "=='''Description'''== =='''Different Plant Structures'''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene symbol ! Gene nam...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Description

Different Plant Structures

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Expressed1[1] expressed protein of unknown function
  • development stage
JF343809
  • F:AGGCCAGTTCCTGCTGAATGTAATGC
  • R:TAGCCTGATCCAAACAAGCCTGGCAA
127 60 SYBR
SAND[1] SAND family protein
  • development stage
JF343810
  • F:GACCCCCTTGCAGACAAAGCATTGGCA
  • R:TCTCGTTCTCAACGTCTTTTACCCACTGG
125 60 SYBR
CACS[1] clathrin adapter complex subunit family protein
  • development stage
JF343811
  • F:AAGACAGTCAGTTTCGTGCCACCTGA
  • R:TCCATGCGTGTTCTACCCAACTCCTT
79 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Natalia V. Demidenko
  • Email: alekseypenin@gmail.com
  • Institute: Department of Genetics, Biological Faculty, M.V. Lomonosov Moscow State University, Moscow, Russia

References

  1. 1.0 1.1 1.2 Demidenko N V, Logacheva M D, Penin A A. Selection and validation of reference genes for quantitative real-time PCR in buckwheat (Fagopyrum esculentum) based on transcriptome sequence data[J]. PLoS One, 2011, 6(5): e19434.