Fagopyrum esculentum

From ICG
Jump to navigation Jump to search

Description

Different Plant Structures

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Expressed1[1] expressed protein of unknown function
  • development stage
JF343809
  • F:AGGCCAGTTCCTGCTGAATGTAATGC
  • R:TAGCCTGATCCAAACAAGCCTGGCAA
127 60 SYBR
SAND[1] SAND family protein
  • development stage
JF343810
  • F:GACCCCCTTGCAGACAAAGCATTGGCA
  • R:TCTCGTTCTCAACGTCTTTTACCCACTGG
125 60 SYBR
CACS[1] clathrin adapter complex subunit family protein
  • development stage
JF343811
  • F:AAGACAGTCAGTTTCGTGCCACCTGA
  • R:TCCATGCGTGTTCTACCCAACTCCTT
79 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Natalia V. Demidenko
  • Email: alekseypenin@gmail.com
  • Institute: Department of Genetics, Biological Faculty, M.V. Lomonosov Moscow State University, Moscow, Russia

Citation Statistics

Cited by 74 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Demidenko N V, Logacheva M D, Penin A A. Selection and validation of reference genes for quantitative real-time PCR in buckwheat (Fagopyrum esculentum) based on transcriptome sequence data[J]. PLoS One, 2011, 6(5): e19434.