Difference between revisions of "Fagus sylvatica"

From ICG
Jump to navigation Jump to search
Line 3: Line 3:
 
* European beech (Fagus sylvatica) is one of the most widespread forest trees in Europe, with a natural distribution range of more than 300,000 km2 extending from Sicily to southern Sweden. Beech is a major timber species, essential to the maintenance of European forest diversity and providing diverse ecosystem services.  
 
* European beech (Fagus sylvatica) is one of the most widespread forest trees in Europe, with a natural distribution range of more than 300,000 km2 extending from Sicily to southern Sweden. Beech is a major timber species, essential to the maintenance of European forest diversity and providing diverse ecosystem services.  
 
* The area covered by beech has increased steadily in recent decades. This species plays a key role in the current shift from intensely managed plantation forests towards largely self-regenerating mixed broadleaf stands<ref name="ref1"/> <ref name="ref2"/>.
 
* The area covered by beech has increased steadily in recent decades. This species plays a key role in the current shift from intensely managed plantation forests towards largely self-regenerating mixed broadleaf stands<ref name="ref1"/> <ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''Beech'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=28930 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Abiotic and Biotic Stress'''''==
 
=='''''Abiotic and Biotic Stress'''''==

Revision as of 01:52, 25 June 2017

Description

REFqPCR200808.jpeg
  • European beech (Fagus sylvatica) is one of the most widespread forest trees in Europe, with a natural distribution range of more than 300,000 km2 extending from Sicily to southern Sweden. Beech is a major timber species, essential to the maintenance of European forest diversity and providing diverse ecosystem services.
  • The area covered by beech has increased steadily in recent decades. This species plays a key role in the current shift from intensely managed plantation forests towards largely self-regenerating mixed broadleaf stands[1] [2].
  • Common Name: Beech
  • NCBI Taxonomy

Abiotic and Biotic Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Act[1] Actin
  • Universal reference gene
AM063027
  • F:AGAGATTCCGTTGCCCAGAA
  • R:TGGATTCCAGCAGCTTCCA
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Dieter Ernst
  • Email: ernst@helmholtz-muenchen.de
  • Institution: Institute of Biochemical Plant Pathology, Helmholtz Zentrum München Ð German Research Center for Environmental Health, D-85764 Neuherberg, Germany

Citation Statistics

Cited by 23 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 Olbrich M, Gerstner E, Welzl G, Fleischmann F, Osswald W, Bahnweg G, Ernst D. Quantification of mRNAs and housekeeping gene selection for quantitative real-time RT-PCR normalization in European beech (Fagus sylvatica L.) during abiotic and biotic stress. Z Naturforsch C. 2008 Jul-Aug;63(7-8):574-82. PubMed PMID: 18811005.
  2. Lesur I, Bechade A, Lalanne C, Klopp C, Noirot C, Leplé JC, Kremer A, Plomion C, Le Provost G. A unigene set for European beech (Fagus sylvatica L.) and its use to decipher the molecular mechanisms involved in dormancy regulation. Mol Ecol Resour. 2015 Sep;15(5):1192-204. doi: 10.1111/1755-0998.12373. Epub 2015 Jan 30. PubMed PMID: 25594128.