View source for Felis catus

=='''Description'''==
[[File:Felis catus.png|right|200px|link=Felis catus]]
*'''''Felis catus''''' is small and typically furry carnivorous mammal. They are often called house cats when kept as indoor pets or simply cats when there is no need to distinguish them from other felids and felines. Cats are often valued by humans for companionship and for their ability to hunt vermin. There are more than 70 cat breeds, though different associations proclaim different numbers according to their standards.
* <font color=blue>'''Common Name:'''</font> '''Domestic cat''', '''Cat'''
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9685 <font color=blue>'''NCBI Taxonomy'''</font>]

=='''''Snap-Frozen Tissues'''''==
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
|-
! Gene Symbol  
! Gene Name 
! style="width=25%　font-size:9pt　"|Application Scope 
! Accession Number 
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp] 
! Tm [℃]
! Detection
|-
|align="center"| RPL17<ref name="ref1"/>
|align="center"| Ribosomal protein L17
|
* Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues
* Liver and kidney tissues
* Different breeds, sexes, ages, and disease status
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/52840003/ '''AY738264'''] 
|nowrap style="font-size:9pt"|
* F:CTCTGGTCATTGAGCACATCC
* R:TCAATGTGGCAGGGAGAGC
|align="center"| 108
|align="center"| 58
|align="center"| SYBR
|-
|align="center"| RPL30<ref name="ref1"/>
|align="center"| Ribosomal protein L30
|
* Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues
* Liver and kidney tissues
* Different breeds, sexes, ages, and disease status
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY700577 '''AY700577'''] 
|nowrap style="font-size:9pt"|
* F:CCTCGGCAGATAAATTGGACTGTC
* R:TGATGGCCCTCTGGAATTTGAC
|align="center"| 111
|align="center"| 64
|align="center"| SYBR
|-
|align="center"| RPS7<ref name="ref1"/>
|align="center"| Clone E472 ribosomal protein S7
|
* Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues
* Liver and kidney tissues
* Different breeds, sexes, ages, and disease status
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY800278 '''AY800278'''] 
|nowrap style="font-size:9pt"|
* F:GTCCCAGAAGCCGCACTTTGAC
* R:CTCTTGCCCACAATCTCGCTCG
|align="center"| 81
|align="center"| 69
|align="center"| SYBR
|-
|align="center"| YWHAZ<ref name="ref1"/>
|align="center"| Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta polypeptide
|
* Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues
* Liver and kidney tissues
* Different breeds, sexes, ages, and disease status
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EF458621 '''EF458621'''] 
|nowrap style="font-size:9pt"|
* F:GAAGAGTCCTACAAAGACAGCACGC
* R:AATTTTCCCCTCCTTCTCCTGC
|align="center"| 115
|align="center"| 65
|align="center"| SYBR
|-
|align="center"|  HPRT<ref name="ref1"/>
|align="center"| Hypoxanthine guanine phosphoribosyl transferase
|
* Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues
* Liver and kidney tissues
* Different breeds, sexes, ages, and disease status
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EF453697 '''EF453697'''] 
|nowrap style="font-size:9pt"|
* F:ACTGTAATGACCAGTCAACAGGGG
* R:TGTATCCAACACTTCGAGGAGTCC
|align="center"| 210
|align="center"| 60
|align="center"| SYBR
|}

===Molecular Types===
* mRNA

===Evaluation Methods===
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
===Contact===
*'''Name''': Louis C. Penning
*'''Email''': L.C.Penning@uu.nl
*'''Institution''': Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 104, PO Box 80154, 3508 TD Utrechet, The Netherlands
===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=7156375107438214938&as_sdt=2005&sciodt=0,5&hl=en '''39'''] (Based on Google Scholar [2017-09-01])

=='''References'''==
<references>
<ref name="ref1">
Penning L C, Vrieling H E, Brinkhof B, et al. A validation of 10 feline reference genes for gene expression measurements in snap-frozen tissues[J]. Veterinary immunology and immunopathology, 2007, 120(3): 212-222.
</ref>
</references>
=='''Categories'''==
[[Category:Animals]]

[[Category:mRNA]]

[[Category:SYBR]]
[[Category:HPRT]] [[Category:RPL]] [[Category:RPL]] [[Category:RPS]] [[Category:YWHAZ]]
[[Category:Specific Tissue]]

[[Category:geNorm]]