Difference between revisions of "Felis catus"

From ICG
Jump to navigation Jump to search
 
(13 intermediate revisions by 4 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
[[File:Felis catus.jpg|right|237px]]
+
[[File:Felis catus.png|right|200px|link=Felis catus]]
*The domestic cat(Latin: Felis catus) is a small, typically furry, carnivorous mammal.  
+
*'''''Felis catus''''' is small and typically furry carnivorous mammal. They are often called house cats when kept as indoor pets or simply cats when there is no need to distinguish them from other felids and felines. Cats are often valued by humans for companionship and for their ability to hunt vermin. There are more than 70 cat breeds, though different associations proclaim different numbers according to their standards.
*They are often called house cats when kept as indoor pets or simply cats when there is no need to distinguish them from other felids and felines.Cats are often valued by humans for companionship and for their ability to hunt vermin. There are more than 70 cat breeds, though different associations proclaim different numbers according to their standards.
+
* <font color=blue>'''Common Name:'''</font> '''Domestic cat''', '''Cat'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9685 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Snap-Frozen Tissues'''''==
 
=='''''Snap-Frozen Tissues'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 20: Line 21:
 
|align="center"| Ribosomal protein L17
 
|align="center"| Ribosomal protein L17
 
|
 
|
*Universal reference genes
+
* Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues
 +
* Liver and kidney tissues
 +
* Different breeds, sexes, ages, and disease status
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/52840003/ '''AY738264''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/52840003/ '''AY738264''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 32: Line 35:
 
|align="center"| Ribosomal protein L30
 
|align="center"| Ribosomal protein L30
 
|
 
|
*Universal reference genes
+
* Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues
 +
* Liver and kidney tissues
 +
* Different breeds, sexes, ages, and disease status
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY700577 '''AY700577''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY700577 '''AY700577''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 44: Line 49:
 
|align="center"| Clone E472 ribosomal protein S7
 
|align="center"| Clone E472 ribosomal protein S7
 
|
 
|
*Universal reference genes
+
* Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues
 +
* Liver and kidney tissues
 +
* Different breeds, sexes, ages, and disease status
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY800278 '''AY800278''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY800278 '''AY800278''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 56: Line 63:
 
|align="center"| Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta polypeptide
 
|align="center"| Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta polypeptide
 
|
 
|
*Universal reference genes
+
* Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues
 +
* Liver and kidney tissues
 +
* Different breeds, sexes, ages, and disease status
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EF458621 '''EF458621''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EF458621 '''EF458621''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 68: Line 77:
 
|align="center"| Hypoxanthine guanine phosphoribosyl transferase
 
|align="center"| Hypoxanthine guanine phosphoribosyl transferase
 
|
 
|
*Universal reference genes
+
* Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues
 +
* Liver and kidney tissues
 +
* Different breeds, sexes, ages, and disease status
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EF453697 '''EF453697''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EF453697 '''EF453697''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 77: Line 88:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
 +
 
===Molecular Types===
 
===Molecular Types===
 
* mRNA
 
* mRNA
Line 87: Line 99:
 
*'''Institution''': Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 104, PO Box 80154, 3508 TD Utrechet, The Netherlands
 
*'''Institution''': Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 104, PO Box 80154, 3508 TD Utrechet, The Netherlands
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''39''' (Based on Google Scholar [2017-06-23])
+
Cited by [https://scholar.google.com/scholar?cites=7156375107438214938&as_sdt=2005&sciodt=0,5&hl=en '''39'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 95: Line 107:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
  
Line 102: Line 115:
 
[[Category:HPRT]] [[Category:RPL]] [[Category:RPL]] [[Category:RPS]] [[Category:YWHAZ]]
 
[[Category:HPRT]] [[Category:RPL]] [[Category:RPL]] [[Category:RPS]] [[Category:YWHAZ]]
 
[[Category:Specific Tissue]]
 
[[Category:Specific Tissue]]
 +
 +
[[Category:geNorm]]

Latest revision as of 07:17, 1 September 2017

Description

Felis catus.png
  • Felis catus is small and typically furry carnivorous mammal. They are often called house cats when kept as indoor pets or simply cats when there is no need to distinguish them from other felids and felines. Cats are often valued by humans for companionship and for their ability to hunt vermin. There are more than 70 cat breeds, though different associations proclaim different numbers according to their standards.
  • Common Name: Domestic cat, Cat
  • NCBI Taxonomy

Snap-Frozen Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPL17[1] Ribosomal protein L17
  • Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues
  • Liver and kidney tissues
  • Different breeds, sexes, ages, and disease status
AY738264
  • F:CTCTGGTCATTGAGCACATCC
  • R:TCAATGTGGCAGGGAGAGC
108 58 SYBR
RPL30[1] Ribosomal protein L30
  • Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues
  • Liver and kidney tissues
  • Different breeds, sexes, ages, and disease status
AY700577
  • F:CCTCGGCAGATAAATTGGACTGTC
  • R:TGATGGCCCTCTGGAATTTGAC
111 64 SYBR
RPS7[1] Clone E472 ribosomal protein S7
  • Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues
  • Liver and kidney tissues
  • Different breeds, sexes, ages, and disease status
AY800278
  • F:GTCCCAGAAGCCGCACTTTGAC
  • R:CTCTTGCCCACAATCTCGCTCG
81 69 SYBR
YWHAZ[1] Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta polypeptide
  • Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues
  • Liver and kidney tissues
  • Different breeds, sexes, ages, and disease status
EF458621
  • F:GAAGAGTCCTACAAAGACAGCACGC
  • R:AATTTTCCCCTCCTTCTCCTGC
115 65 SYBR
HPRT[1] Hypoxanthine guanine phosphoribosyl transferase
  • Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues
  • Liver and kidney tissues
  • Different breeds, sexes, ages, and disease status
EF453697
  • F:ACTGTAATGACCAGTCAACAGGGG
  • R:TGTATCCAACACTTCGAGGAGTCC
210 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Louis C. Penning
  • Email: L.C.Penning@uu.nl
  • Institution: Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 104, PO Box 80154, 3508 TD Utrechet, The Netherlands

Citation Statistics

Cited by 39 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Penning L C, Vrieling H E, Brinkhof B, et al. A validation of 10 feline reference genes for gene expression measurements in snap-frozen tissues[J]. Veterinary immunology and immunopathology, 2007, 120(3): 212-222.

Categories