Difference between revisions of "Felis catus"

From ICG
Jump to navigation Jump to search
Line 12: Line 12:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 20: Line 20:
 
|align="center"| ribosomal protein L17
 
|align="center"| ribosomal protein L17
 
|
 
|
Universal reference genes
+
*Universal reference genes
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/52840003/ '''AY738264''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/52840003/ '''AY738264''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 32: Line 32:
 
|align="center"| ribosomal protein L30
 
|align="center"| ribosomal protein L30
 
|
 
|
Universal reference genes
+
*Universal reference genes
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY700577 '''AY700577''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY700577 '''AY700577''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 44: Line 44:
 
|align="center"| clone E472 ribosomal protein S7
 
|align="center"| clone E472 ribosomal protein S7
 
|
 
|
Universal reference genes
+
*Universal reference genes
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY800278 '''AY800278''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AY800278 '''AY800278''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 56: Line 56:
 
|align="center"| tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta polypeptide
 
|align="center"| tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta polypeptide
 
|
 
|
Universal reference genes
+
*Universal reference genes
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EF458621 '''EF458621''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EF458621 '''EF458621''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 68: Line 68:
 
|align="center"| hypoxanthine guanine phosphoribosyl transferase
 
|align="center"| hypoxanthine guanine phosphoribosyl transferase
 
|
 
|
Universal reference genes
+
*Universal reference genes
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EF453697 '''EF453697''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/EF453697 '''EF453697''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|

Revision as of 11:44, 20 June 2017

Description

Felis catus.jpg
  • The domestic cat(Latin: Felis catus) is a small, typically furry, carnivorous mammal.
  • They are often called house cats when kept as indoor pets or simply cats when there is no need to distinguish them from other felids and felines.Cats are often valued by humans for companionship and for their ability to hunt vermin. There are more than 70 cat breeds, though different associations proclaim different numbers according to their standards.

Snap-Frozen Tissues

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPL17[1] ribosomal protein L17
  • Universal reference genes
AY738264
  • F:CTCTGGTCATTGAGCACATCC
  • R:TCAATGTGGCAGGGAGAGC
108 58 SYBR
RPL30[1] ribosomal protein L30
  • Universal reference genes
AY700577
  • F:CCTCGGCAGATAAATTGGACTGTC
  • R:TGATGGCCCTCTGGAATTTGAC
111 64 SYBR
RPS7[1] clone E472 ribosomal protein S7
  • Universal reference genes
AY800278
  • F:GTCCCAGAAGCCGCACTTTGAC
  • R:CTCTTGCCCACAATCTCGCTCG
81 69 SYBR
YWHAZ[1] tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta polypeptide
  • Universal reference genes
EF458621
  • F:GAAGAGTCCTACAAAGACAGCACGC
  • R:AATTTTCCCCTCCTTCTCCTGC
115 65 SYBR
HPRT[1] hypoxanthine guanine phosphoribosyl transferase
  • Universal reference genes
EF453697
  • F:ACTGTAATGACCAGTCAACAGGGG
  • R:TGTATCCAACACTTCGAGGAGTCC
210 60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Louis C. Penning
  • Email: L.C.Penning@uu.nl
  • Institution: Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 104, PO Box 80154, 3508 TD Utrechet, The Netherlands

Citation Statistics

Cited by 40 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 1.4 Penning L C, Vrieling H E, Brinkhof B, et al. A validation of 10 feline reference genes for gene expression measurements in snap-frozen tissues[J]. Veterinary immunology and immunopathology, 2007, 120(3): 212-222.