Felis catus

From ICG
Revision as of 07:17, 1 September 2017 by Niu Guangyi (talk | contribs) (→‎Citation Statistics)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Description

Felis catus.png
  • Felis catus is small and typically furry carnivorous mammal. They are often called house cats when kept as indoor pets or simply cats when there is no need to distinguish them from other felids and felines. Cats are often valued by humans for companionship and for their ability to hunt vermin. There are more than 70 cat breeds, though different associations proclaim different numbers according to their standards.
  • Common Name: Domestic cat, Cat
  • NCBI Taxonomy

Snap-Frozen Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPL17[1] Ribosomal protein L17
  • Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues
  • Liver and kidney tissues
  • Different breeds, sexes, ages, and disease status
AY738264
  • F:CTCTGGTCATTGAGCACATCC
  • R:TCAATGTGGCAGGGAGAGC
108 58 SYBR
RPL30[1] Ribosomal protein L30
  • Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues
  • Liver and kidney tissues
  • Different breeds, sexes, ages, and disease status
AY700577
  • F:CCTCGGCAGATAAATTGGACTGTC
  • R:TGATGGCCCTCTGGAATTTGAC
111 64 SYBR
RPS7[1] Clone E472 ribosomal protein S7
  • Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues
  • Liver and kidney tissues
  • Different breeds, sexes, ages, and disease status
AY800278
  • F:GTCCCAGAAGCCGCACTTTGAC
  • R:CTCTTGCCCACAATCTCGCTCG
81 69 SYBR
YWHAZ[1] Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta polypeptide
  • Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues
  • Liver and kidney tissues
  • Different breeds, sexes, ages, and disease status
EF458621
  • F:GAAGAGTCCTACAAAGACAGCACGC
  • R:AATTTTCCCCTCCTTCTCCTGC
115 65 SYBR
HPRT[1] Hypoxanthine guanine phosphoribosyl transferase
  • Dental roots and crowns, heart (left ventricle), renal, liver, lung, and mammary gland tissues
  • Liver and kidney tissues
  • Different breeds, sexes, ages, and disease status
EF453697
  • F:ACTGTAATGACCAGTCAACAGGGG
  • R:TGTATCCAACACTTCGAGGAGTCC
210 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Louis C. Penning
  • Email: L.C.Penning@uu.nl
  • Institution: Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 104, PO Box 80154, 3508 TD Utrechet, The Netherlands

Citation Statistics

Cited by 39 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Penning L C, Vrieling H E, Brinkhof B, et al. A validation of 10 feline reference genes for gene expression measurements in snap-frozen tissues[J]. Veterinary immunology and immunopathology, 2007, 120(3): 212-222.

Categories