Difference between revisions of "Festuca arundinacea"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
==Description==
 
==Description==
 
[[File:REFqPCR2015022-1.jpg|right|327px|]]
 
[[File:REFqPCR2015022-1.jpg|right|327px|]]
−
* Tall fescue (Festuca arundinacea Schreb.) is widely utilized as a major forage and turfgrass species in the temperate regions of the world and is a valuable plant material for studying molecular mechanismsof grass stress tolerance due to its superior drought and heat tolerance among cool-season species.
+
* '''''Festuca arundinacea Schreb''''' is widely utilized as a major forage and turfgrass species in the temperate regions of the world. Tall fescue possesses superior drought and heat tolerance among cool-season perennial forage and turfgrass species and is typically used as model species to identify molecular mechanisms of stress tolerance in perennial grasses. As a long-lived perennial bunchgrass species, it grows vigorously and has prominent weed and disease tolerance<ref name="ref1"/><ref name="ref2"/>.
−
* Tall fescue (Festuca arundinacea Schreb.) is the most widely-used cool-season species as forageand turfowing to its high qualityand productivity, aswellasa widerange ofstressadaptation. Tall fescue possesses superior drought and heat tolerance among cool-season perennial forage and turfgrass species and is typically used as model species to identify molecular mechanisms of stress tolerancein perennial grasses.
 
−
* Tall fescue (Festuca arundinacea), belonging to the grass family Poaceae, subfamily Pooideae, and tribe Triticeae, is a hexaploid outcrossing species with a genome size of about 5.27–5.83 × 106 kilobase (kb). Tall fescue is a major cool-season grass that is widely distributed in temperate regions throughout the world. As a long-lived perennial bunchgrass species, it grows vigorously and has prominent weed and disease tolerance.  <ref name="ref1"/> <ref name="ref2"/>.
 
 
* <font color=blue>'''Common Name:'''</font> '''Tall fescue'''
 
* <font color=blue>'''Common Name:'''</font> '''Tall fescue'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4606 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4606 <font color=blue>'''NCBI Taxonomy'''</font>]

Revision as of 14:47, 27 June 2017

Description

REFqPCR2015022-1.jpg
  • Festuca arundinacea Schreb is widely utilized as a major forage and turfgrass species in the temperate regions of the world. Tall fescue possesses superior drought and heat tolerance among cool-season perennial forage and turfgrass species and is typically used as model species to identify molecular mechanisms of stress tolerance in perennial grasses. As a long-lived perennial bunchgrass species, it grows vigorously and has prominent weed and disease tolerance[1][2].
  • Common Name: Tall fescue
  • NCBI Taxonomy

Abiotic Stresses

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Roots and leaves under drought stress
 GT035008
  • F:TGAGAAGGCAGCCACCTATG
  • R:TGCTGTCACCCTGGAAGTCA
 125 58 SYBR
TIP41[1] TIP41-like family protein
  • Roots and leaves under drought stress
  • Salt-treated roots or leaves
  • Cold-treated roots & leaves
  • Heat-stressed leaves
 DT690696
  • F:GAACCAAGACACTATGCAAACA
  • R:GAAATACCACTATCCGCTAACTCA
 162 58 SYBR
TUB[1] Alpha Tubulin
  • Roots and leaves under drought stress
  • Salt-treated roots or leaves
  • Cold-treated roots & leaves
  • Heat-stressed leaves
 GT051159
  • F:ATGCTTTCGTCTTATGCCC
  • R:CTCTTGGTTTTGATGGTTGC
 215 58 SYBR
PEPKR1[1] Phosphoenolpyruvate carboxylase-related Kinase 1
  • Cold-treated roots
 DT688788
  • F:GAACATCCTCCTTGTCAGCA
  • R:CCTCATTGTAACCGCCAGA
 155 58 SYBR
F-box[1] F-box/kelch-repeat protein
  • Cold-treated leaves
 GT039249
  • F:GCCAAATGTCTGGTGCTTAG
  • R:TCATCCGCTTCGTCTTCAA
 101 58 SYBR
CACS[1] Clathrin adaptor complex subunit
  • Heat-stressed roots
 GT044151
  • F:TCGCTACATCACGAGGGCT
  • R:AACAGGATACGGGGGAAGAATA
 255 58 SYBR
ACT[1] Actin7
  • Heat-stressed leaves
 GT038376
  • F:AGATCAAGGTCGTTGCTCCA
  • R:CTCCCAGACTAGACGATACAGC
 189 58 SYBR
SAND[1] SAND family protein
  • Salt-treated roots or leaves
 GT037941
  • F:ACCCAAGATTTCGAGCTGTAT
  • R:AACCTAAACCTCACATATCTCCC
 188 58 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zhimin Yang
  • Email: nauyzm@njau.edu.cn
  • Institution: College of Agro-grassland Science, Nanjing Agricultural University, Nanjing, Jiangsu, China

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-06-16])

References

  1. ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 Yang Z, Chen Y, Hu B, Tan Z, Huang B (2015) Identification and validation of reference genes for quantification of target gene expression with quantitative real-time PCR for tall fescue under four abiotic stresses. PLoS One 10, e0119569.
  2. ↑ Li H, Hu T, Amombo E, Fu J (2017) Genome-wide identification of heat stress-responsive small RNAs in tall fescue (Festuca arundinacea) by high-throughput sequencing. J Plant Physiol 213, 157-165.

　　

Retrieved from "http://192.168.164.12:9052/index.php?title=Festuca_arundinacea&oldid=4384"