Difference between revisions of "Festuca arundinacea"

From ICG
Jump to navigation Jump to search
(Created page with "==Description== right|327px| * Tall fescue (Festuca arundinacea Schreb.) is widely utilized as a major forage and turfgrass species in the temper...")
 
 
(18 intermediate revisions by 7 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:REFqPCR2015022-1.jpg|right|327px|]]
+
[[File:Festuca arundinacea.png|right|200px|link=Festuca arundinacea]]
* Tall fescue (Festuca arundinacea Schreb.) is widely utilized as a major forage and turfgrass species in the temperate regions of the world and is a valuable plant material for studying molecular mechanismsof grass stress tolerance due to its superior drought and heat tolerance among cool-season species.
+
* '''''Festuca arundinacea Schreb''''' is widely utilized as a major forage and turfgrass species in the temperate regions of the world. Tall fescue possesses superior drought and heat tolerance among cool-season perennial forage and turfgrass species and is typically used as model species to identify molecular mechanisms of stress tolerance in perennial grasses. As a long-lived perennial bunchgrass species, it grows vigorously and has prominent weed and disease tolerance<ref name="ref1"/><ref name="ref2"/>.
* Tall fescue (Festuca arundinacea Schreb.) is the most widely-used cool-season species as forageand turfowing to its high qualityand productivity, aswellasa widerange ofstressadaptation. Tall fescue possesses superior drought and heat tolerance among cool-season perennial forage and turfgrass species and is typically used as model species to identify molecular mechanisms of stress tolerancein perennial grasses.
+
* <font color=blue>'''Common Name:'''</font> '''Tall fescue'''
* Tall fescue (Festuca arundinacea), belonging to the grass family Poaceae, subfamily Pooideae, and tribe Triticeae, is a hexaploid outcrossing species with a genome size of about 5.27–5.83 × 106 kilobase (kb). Tall fescue is a major cool-season grass that is widely distributed in temperate regions throughout the world. As a long-lived perennial bunchgrass species, it grows vigorously and has prominent weed and disease tolerance<ref name="ref1"/> <ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4606 <font color=blue>'''NCBI Taxonomy'''</font>]
 +
 
 
=='''''Abiotic Stresses'''''==
 
=='''''Abiotic Stresses'''''==
  
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 13: Line 14:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 19: Line 20:
 
|-
 
|-
 
|align="center"| GAPDH<ref name="ref1"/>
 
|align="center"| GAPDH<ref name="ref1"/>
|align="center"| glyceraldehyde 3-phosphate dehydrogenase
+
|align="center"| Glyceraldehyde 3-phosphate dehydrogenase
 
|
 
|
 
* Roots and leaves under drought stress  
 
* Roots and leaves under drought stress  
Line 25: Line 26:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TGAGAAGGCAGCCACCTATG
 
* F:TGAGAAGGCAGCCACCTATG
* R:TGAGAAGGCAGCCACCTATG
+
* R:TGCTGTCACCCTGGAAGTCA
 
|align="center"|  125  
 
|align="center"|  125  
 
|align="center"| 58
 
|align="center"| 58
Line 40: Line 41:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GAACCAAGACACTATGCAAACA
 
* F:GAACCAAGACACTATGCAAACA
* R:GAACCAAGACACTATGCAAACA
+
* R:GAAATACCACTATCCGCTAACTCA
 
|align="center"|  162  
 
|align="center"|  162  
 
|align="center"| 58
 
|align="center"| 58
Line 55: Line 56:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:ATGCTTTCGTCTTATGCCC
 
* F:ATGCTTTCGTCTTATGCCC
* R:ATGCTTTCGTCTTATGCCC
+
* R:CTCTTGGTTTTGATGGTTGC
 
|align="center"|  215  
 
|align="center"|  215  
 
|align="center"| 58
 
|align="center"| 58
Line 67: Line 68:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GAACATCCTCCTTGTCAGCA
 
* F:GAACATCCTCCTTGTCAGCA
* R:GAACATCCTCCTTGTCAGCA
+
* R:CCTCATTGTAACCGCCAGA
 
|align="center"|  155  
 
|align="center"|  155  
 
|align="center"| 58
 
|align="center"| 58
Line 79: Line 80:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GCCAAATGTCTGGTGCTTAG
 
* F:GCCAAATGTCTGGTGCTTAG
* R:GCCAAATGTCTGGTGCTTAG
+
* R:TCATCCGCTTCGTCTTCAA
 
|align="center"|  101  
 
|align="center"|  101  
 
|align="center"| 58
 
|align="center"| 58
Line 85: Line 86:
 
|-
 
|-
 
|align="center"| CACS<ref name="ref1"/>
 
|align="center"| CACS<ref name="ref1"/>
|align="center"| clathrin adaptor complex subunit
+
|align="center"| Clathrin adaptor complex subunit
 
|
 
|
 
* Heat-stressed roots  
 
* Heat-stressed roots  
Line 91: Line 92:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TCGCTACATCACGAGGGCT
 
* F:TCGCTACATCACGAGGGCT
* R:TCGCTACATCACGAGGGCT
+
* R:AACAGGATACGGGGGAAGAATA
 
|align="center"|  255  
 
|align="center"|  255  
 
|align="center"| 58
 
|align="center"| 58
Line 103: Line 104:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:AGATCAAGGTCGTTGCTCCA
 
* F:AGATCAAGGTCGTTGCTCCA
* R:AGATCAAGGTCGTTGCTCCA
+
* R:CTCCCAGACTAGACGATACAGC
 
|align="center"|  189  
 
|align="center"|  189  
 
|align="center"| 58
 
|align="center"| 58
Line 115: Line 116:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:ACCCAAGATTTCGAGCTGTAT
 
* F:ACCCAAGATTTCGAGCTGTAT
* R:ACCCAAGATTTCGAGCTGTAT
+
* R:AACCTAAACCTCACATATCTCCC
 
|align="center"|  188  
 
|align="center"|  188  
 
|align="center"| 58
 
|align="center"| 58
Line 121: Line 122:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 133: Line 135:
 
*'''Email''': nauyzm@njau.edu.cn
 
*'''Email''': nauyzm@njau.edu.cn
 
*'''Institution''': College of Agro-grassland Science, Nanjing Agricultural University, Nanjing, Jiangsu, China
 
*'''Institution''': College of Agro-grassland Science, Nanjing Agricultural University, Nanjing, Jiangsu, China
 +
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=15511454582359549543&as_sdt=2005&sciodt=0,5&hl=en'''12'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 143: Line 148:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 +
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:ACT]] [[Category:CACS]] [[Category:F-box]] [[Category:GAPDH]] [[Category:PEPKR]] [[Category:SAND]] [[Category:TIP41]] [[Category:Tubulin]][[Category:Abiotic Stress]]
 +
[[Category:geNorm]][[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:Delta Ct]]
 +
[[Category:RefFinder]]

Latest revision as of 06:43, 1 September 2017

Description

Festuca arundinacea.png
  • Festuca arundinacea Schreb is widely utilized as a major forage and turfgrass species in the temperate regions of the world. Tall fescue possesses superior drought and heat tolerance among cool-season perennial forage and turfgrass species and is typically used as model species to identify molecular mechanisms of stress tolerance in perennial grasses. As a long-lived perennial bunchgrass species, it grows vigorously and has prominent weed and disease tolerance[1][2].
  • Common Name: Tall fescue
  • NCBI Taxonomy

Abiotic Stresses

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Roots and leaves under drought stress
GT035008
  • F:TGAGAAGGCAGCCACCTATG
  • R:TGCTGTCACCCTGGAAGTCA
125 58 SYBR
TIP41[1] TIP41-like family protein
  • Roots and leaves under drought stress
  • Salt-treated roots or leaves
  • Cold-treated roots & leaves
  • Heat-stressed leaves
DT690696
  • F:GAACCAAGACACTATGCAAACA
  • R:GAAATACCACTATCCGCTAACTCA
162 58 SYBR
TUB[1] Alpha Tubulin
  • Roots and leaves under drought stress
  • Salt-treated roots or leaves
  • Cold-treated roots & leaves
  • Heat-stressed leaves
GT051159
  • F:ATGCTTTCGTCTTATGCCC
  • R:CTCTTGGTTTTGATGGTTGC
215 58 SYBR
PEPKR1[1] Phosphoenolpyruvate carboxylase-related Kinase 1
  • Cold-treated roots
DT688788
  • F:GAACATCCTCCTTGTCAGCA
  • R:CCTCATTGTAACCGCCAGA
155 58 SYBR
F-box[1] F-box/kelch-repeat protein
  • Cold-treated leaves
GT039249
  • F:GCCAAATGTCTGGTGCTTAG
  • R:TCATCCGCTTCGTCTTCAA
101 58 SYBR
CACS[1] Clathrin adaptor complex subunit
  • Heat-stressed roots
GT044151
  • F:TCGCTACATCACGAGGGCT
  • R:AACAGGATACGGGGGAAGAATA
255 58 SYBR
ACT[1] Actin7
  • Heat-stressed leaves
GT038376
  • F:AGATCAAGGTCGTTGCTCCA
  • R:CTCCCAGACTAGACGATACAGC
189 58 SYBR
SAND[1] SAND family protein
  • Salt-treated roots or leaves
GT037941
  • F:ACCCAAGATTTCGAGCTGTAT
  • R:AACCTAAACCTCACATATCTCCC
188 58 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zhimin Yang
  • Email: nauyzm@njau.edu.cn
  • Institution: College of Agro-grassland Science, Nanjing Agricultural University, Nanjing, Jiangsu, China

Citation Statistics

Cited by 12 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 Yang Z, Chen Y, Hu B, Tan Z, Huang B (2015) Identification and validation of reference genes for quantification of target gene expression with quantitative real-time PCR for tall fescue under four abiotic stresses. PLoS One 10, e0119569.
  2. Li H, Hu T, Amombo E, Fu J (2017) Genome-wide identification of heat stress-responsive small RNAs in tall fescue (Festuca arundinacea) by high-throughput sequencing. J Plant Physiol 213, 157-165.

Categories