Difference between revisions of "Fragaria ananassa"

From ICG
Jump to navigation Jump to search
 
(30 intermediate revisions by 7 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
−
[[File:REFqPCR2015003-1.jpg|right|227px|]]
+
[[File:Fragaria ananassa.png|right|200px|link=Fragaria ananassa]]
−
* Strawberry (Fragaria × ananassa Duch) is one of the most economically important fruit crops worldwide. The increasing cultivation areas and the rising consumption of strawberry fruits are associated with its pleasant flavor, taste and texture, as well as with their essential nutrients, minerals, vitamins, and antioxidant compounds. The antioxidant properties of strawberry fruits are related to the high content of L-ascorbic acid (vitamin C), anthocyanins and phenolic compounds, which have been medically recognized as having positive influences on protecting against the risk of many diseases.
+
* '''''Fragaria ananassa Duch''''' is one of the most economically important fruit crops worldwide. The increasing cultivation areas and the rising consumption of strawberry fruits are associated with their sensorial characteristics such as pleasant flavor, taste and texture, as well as with their essential nutrients, minerals, vitamins, and antioxidant compounds. The antioxidant properties of strawberry fruits are related to the high content of L-ascorbic acid (vitamin C), anthocyanins and phenolic compounds, which have been medically recognized as having positive influences on protecting against the risk of many diseases<ref name="ref1"/><ref name="ref2"/>.
−
* The increasing demand of strawberry (Fragaria × ananassa Duch) fruits is associated mainly with their sensorial characteristics and the content of antioxidant compounds.<ref name="ref1"/> <ref name="ref2"/>.
+
* <font color=blue>'''Common Name:'''</font> '''Garden strawberry''','''Strawberry'''
−
* <font color=blue>'''Common Name:'''</font> '''Garden strawberry'''
 
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3747 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3747 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Cultivars & Osmotic Stress'''''==
 
=='''''Different Cultivars & Osmotic Stress'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 22: Line 21:
 
|align="center"| DNA binding protein
 
|align="center"| DNA binding protein
 
|
 
|
−
* Drought stress condition
+
* Drought stress  
−
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/198449162 '''''EU727547''''']  
+
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/198449162 '''EU727547''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TTGGCAGCGGGACTTTACC
 
* F:TTGGCAGCGGGACTTTACC
Line 32: Line 31:
 
|-
 
|-
 
|align="center"| HISTH4<ref name="ref1"/>
 
|align="center"| HISTH4<ref name="ref1"/>
−
|align="center"| mRNA for histone H4, partial cds
+
|align="center"| Histone H4
 
|
 
|
−
* Osmotic stresses and salt stress  
+
* Osmotic stress
 +
* Salt stress
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AB197150.1 '''AB197150.1''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AB197150.1 '''AB197150.1''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 59: Line 59:
  
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''0''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=15247377201972822122&as_sdt=2005&sciodt=0,5&hl=en '''26'''] (Based on Google Scholar [2017-09-01])
 +
 
 +
=='''''Different Developmental Stages & Tissues'''''==
 +
===Internal Control Genes===
 +
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 +
|-
 +
! Gene Symbol 
 +
! Gene Name
 +
! style="width=25%　font-size:9pt　"|Application Scope
 +
! Accession Number
 +
! Primers (5'-3')<br>[Forward/Reverse]
 +
! Size [bp]
 +
! Tm [℃]
 +
! Detection
 +
|-
 +
|align="center"| FaRIB413<ref name="ref3"/>
 +
|align="center"| RNA interspacer (16S–23S) region
 +
|
 +
*Different tissues
 +
*Strawberry cultivars
 +
*Biotic stresses
 +
*Ripening and senescent conditions
 +
*SA/JA treatments
 +
|align="center"| gene33863 (Fragaria vesca orthologe (a))
 +
|nowrap style="font-size:9pt"|
 +
* F:ACCGTTGATTCGCACAATTGGTCATCG
 +
* R:TACTGCGGGTCGGCAATCGGACG
 +
|align="center"| 149
 +
|align="center"| 65
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| FaACTIN<ref name="ref3"/>
 +
|align="center"| Actin
 +
|
 +
*Different tissues
 +
*Strawberry cultivars
 +
*Biotic stresses
 +
*Ripening and senescent conditions
 +
*SA/JA treatments
 +
|align="center"| Actin (Fragaria vesca orthologe (a))
 +
|nowrap style="font-size:9pt"|
 +
* F:GGGCCAGAAAGATGCTTATGTCGG
 +
* R:GGGCAACACGAAGCTCATTGTAGAAG
 +
|align="center"| 152
 +
|align="center"| 65
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| FaEF1α<ref name="ref3"/>
 +
|align="center"| Elongation factor 1-alpha
 +
|
 +
*Different tissues
 +
*Strawberry cultivars
 +
*Biotic stresses
 +
*Ripening and senescent conditions
 +
*SA/JA treatments
 +
|align="center"| gene28639, gene28622,gene23217(Fragaria vesca orthologe (a))
 +
|nowrap style="font-size:9pt"|
 +
* F:TGGATTTGAGGGTGACAACATGA
 +
* R:GTATACATCCTGAAGTGGTAGACGGAGG
 +
|align="center"| 145
 +
|align="center"| 65
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| FaGAPDH2<ref name="ref3"/>
 +
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 +
|
 +
*Different tissues
 +
*Strawberry cultivars
 +
*Biotic stresses
 +
*Ripening and senescent conditions
 +
*SA/JA treatments
 +
|align="center"| gene07104 (Fragaria vesca orthologe (a))
 +
|nowrap style="font-size:9pt"|
 +
* F:CCCAAGTAAGGATGCCCCCATGTTCG
 +
* R:TTGGCAAGGGGAGCAAGACAGTTGGTAG
 +
|align="center"| 117
 +
|align="center"| 65
 +
|align="center"| SYBR
 +
|}
 +
===Molecular Types===
 +
*mRNA
 +
 
 +
===Evaluation Methods===
 +
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 +
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 +
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference''']
 +
===Contact===
 +
*'''Name''': Jose´ L. Caballero
 +
*'''Email''': bb1carej@uco.es
 +
*'''Institution''': Departamento de Bioquı ´mica y Biologı ´a Molecular e Instituto Andaluz de Biotecnologı ´a, Campus Universitario de Rabanales y Campus de Excelencia Internacional Agroalimentario-CEIA3, Universidad de Co´rdoba, Co´rdoba, Andalucı ´a, Spain
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=11135432604107466419&as_sdt=2005&sciodt=0,5&hl=en '''35'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 68: Line 159:
 
<ref name="ref2">
 
<ref name="ref2">
 
Arend GD, Adorno WT, Rezzadori K, et al. (2017) Concentration of phenolic compounds from strawberry (Fragaria X ananassa Duch) juice by nanofiltration membrane. Journal of Food Engineering 201, 36-41.
 
Arend GD, Adorno WT, Rezzadori K, et al. (2017) Concentration of phenolic compounds from strawberry (Fragaria X ananassa Duch) juice by nanofiltration membrane. Journal of Food Engineering 201, 36-41.
 +
</ref>
 +
<ref name="ref3">
 +
Amil-Ruiz, Francisco, et al. Identification and validation of reference genes for transcript normalization in strawberry (Fragaria× ananassa) defense responses. PloS one 8.8 (2013): e70603.
 
</ref>
 
</ref>
 
</references>
 
</references>
  
 +
=='''Categories'''==
 
[[Category:Plants]]
 
[[Category:Plants]]
−
[[Category:mRNA]]　
+
[[Category:mRNA]][[Category:SYBR]]
−
[[Category:SYBR]]
+
[[Category:DBP]] [[Category:Histone]] [[Category:Osmotic Stress]] [[Category:Different Cultivars]]
−
[[Category:DBP]] [[Category:Histone]][[Category:Osmotic Stress]] [[Category:Different Cultivars]]
+
[[Category:Different Developmental Stages]] [[Category:Different Tissues]]
 +
[[Category:ACT]] [[Category:GAPDH]] [[Category:EF1α]] [[Category:RIB]]
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:Delta Ct]]
 +
[[Category:RefFinder]]

Latest revision as of 07:22, 1 September 2017

Description

Fragaria ananassa.png
  • Fragaria ananassa Duch is one of the most economically important fruit crops worldwide. The increasing cultivation areas and the rising consumption of strawberry fruits are associated with their sensorial characteristics such as pleasant flavor, taste and texture, as well as with their essential nutrients, minerals, vitamins, and antioxidant compounds. The antioxidant properties of strawberry fruits are related to the high content of L-ascorbic acid (vitamin C), anthocyanins and phenolic compounds, which have been medically recognized as having positive influences on protecting against the risk of many diseases[1][2].
  • Common Name: Garden strawberry,Strawberry
  • NCBI Taxonomy

Different Cultivars & Osmotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
DBP[1] DNA binding protein
  • Drought stress
 EU727547
  • F:TTGGCAGCGGGACTTTACC
  • R:CGGTTGTGTGACGCTGTCAT
 NA 79.54 SYBR
HISTH4[1] Histone H4
  • Osmotic stress
  • Salt stress
 AB197150.1
  • F:GTGGCGTCAAGCGTATCTCC
  • R:TGTCCTTCCCTGCCTCTTGA
 167 88.27 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Vanessa Galli
  • Email: vane.galli@yahoo.com.br
  • Institution: Embrapa Clima Temperado, Rodovia BR 396, Km 78 Caixa Postal 403, CEP 96001-970 Pelotas, RS, Brazil

Citation Statistics

Cited by 26 (Based on Google Scholar [2017-09-01])

Different Developmental Stages & Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
FaRIB413[3] RNA interspacer (16S–23S) region
  • Different tissues
  • Strawberry cultivars
  • Biotic stresses
  • Ripening and senescent conditions
  • SA/JA treatments
 gene33863 (Fragaria vesca orthologe (a))
  • F:ACCGTTGATTCGCACAATTGGTCATCG
  • R:TACTGCGGGTCGGCAATCGGACG
 149 65 SYBR
FaACTIN[3] Actin
  • Different tissues
  • Strawberry cultivars
  • Biotic stresses
  • Ripening and senescent conditions
  • SA/JA treatments
 Actin (Fragaria vesca orthologe (a))
  • F:GGGCCAGAAAGATGCTTATGTCGG
  • R:GGGCAACACGAAGCTCATTGTAGAAG
 152 65 SYBR
FaEF1α[3] Elongation factor 1-alpha
  • Different tissues
  • Strawberry cultivars
  • Biotic stresses
  • Ripening and senescent conditions
  • SA/JA treatments
 gene28639, gene28622,gene23217(Fragaria vesca orthologe (a))
  • F:TGGATTTGAGGGTGACAACATGA
  • R:GTATACATCCTGAAGTGGTAGACGGAGG
 145 65 SYBR
FaGAPDH2[3] Glyceraldehyde-3-phosphate dehydrogenase
  • Different tissues
  • Strawberry cultivars
  • Biotic stresses
  • Ripening and senescent conditions
  • SA/JA treatments
 gene07104 (Fragaria vesca orthologe (a))
  • F:CCCAAGTAAGGATGCCCCCATGTTCG
  • R:TTGGCAAGGGGAGCAAGACAGTTGGTAG
 117 65 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jose´ L. Caballero
  • Email: bb1carej@uco.es
  • Institution: Departamento de Bioquı ´mica y Biologı ´a Molecular e Instituto Andaluz de Biotecnologı ´a, Campus Universitario de Rabanales y Campus de Excelencia Internacional Agroalimentario-CEIA3, Universidad de Co´rdoba, Co´rdoba, Andalucı ´a, Spain

Citation Statistics

Cited by 35 (Based on Google Scholar [2017-09-01])

References

  1. ↑ 1.0 1.1 1.2 Galli V, Borowski JM, Perin EC, et al. (2015) Validation of reference genes for accurate normalization of gene expression for real time-quantitative PCR in strawberry fruits using different cultivars and osmotic stresses. Gene 554, 205-214.
  2. ↑ Arend GD, Adorno WT, Rezzadori K, et al. (2017) Concentration of phenolic compounds from strawberry (Fragaria X ananassa Duch) juice by nanofiltration membrane. Journal of Food Engineering 201, 36-41.
  3. ↑ 3.0 3.1 3.2 3.3 Amil-Ruiz, Francisco, et al. Identification and validation of reference genes for transcript normalization in strawberry (Fragaria× ananassa) defense responses. PloS one 8.8 (2013): e70603.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Fragaria_ananassa&oldid=8763"