Difference between revisions of "Fragaria ananassa"
Jump to navigation
Jump to search
ICG Expert4 (talk | contribs) |
Wangzhennan (talk | contribs) |
||
(40 intermediate revisions by 9 users not shown) | |||
Line 1: | Line 1: | ||
==Description== | ==Description== | ||
− | [[File: | + | [[File:Fragaria ananassa.png|right|200px|link=Fragaria ananassa]] |
− | * | + | * '''''Fragaria ananassa Duch''''' is one of the most economically important fruit crops worldwide. The increasing cultivation areas and the rising consumption of strawberry fruits are associated with their sensorial characteristics such as pleasant flavor, taste and texture, as well as with their essential nutrients, minerals, vitamins, and antioxidant compounds. The antioxidant properties of strawberry fruits are related to the high content of L-ascorbic acid (vitamin C), anthocyanins and phenolic compounds, which have been medically recognized as having positive influences on protecting against the risk of many diseases<ref name="ref1"/><ref name="ref2"/>. |
− | + | * <font color=blue>'''Common Name:'''</font> '''Garden strawberry''','''Strawberry''' | |
+ | * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3747 <font color=blue>'''NCBI Taxonomy'''</font>] | ||
− | =='''''Different Cultivars & Osmotic | + | =='''''Different Cultivars & Osmotic Stress'''''== |
− | === | + | ===Internal Control Genes=== |
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 12: | Line 13: | ||
! style="width=25% font-size:9pt "|Application Scope | ! style="width=25% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
Line 20: | Line 21: | ||
|align="center"| DNA binding protein | |align="center"| DNA binding protein | ||
| | | | ||
− | * Drought stress | + | * Drought stress |
− | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/198449162 | + | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/198449162 '''EU727547'''] |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:TTGGCAGCGGGACTTTACC | * F:TTGGCAGCGGGACTTTACC | ||
− | * R: | + | * R:CGGTTGTGTGACGCTGTCAT |
|align="center"| NA | |align="center"| NA | ||
|align="center"| 79.54 | |align="center"| 79.54 | ||
Line 30: | Line 31: | ||
|- | |- | ||
|align="center"| HISTH4<ref name="ref1"/> | |align="center"| HISTH4<ref name="ref1"/> | ||
− | |align="center"| | + | |align="center"| Histone H4 |
| | | | ||
− | * Osmotic | + | * Osmotic stress |
+ | * Salt stress | ||
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AB197150.1 '''AB197150.1'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AB197150.1 '''AB197150.1'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:GTGGCGTCAAGCGTATCTCC | * F:GTGGCGTCAAGCGTATCTCC | ||
− | * R: | + | * R:TGTCCTTCCCTGCCTCTTGA |
|align="center"| 167 | |align="center"| 167 | ||
|align="center"| 88.27 | |align="center"| 88.27 | ||
Line 42: | Line 44: | ||
|} | |} | ||
− | === | + | ===Molecular Types=== |
*mRNA | *mRNA | ||
+ | |||
===Evaluation Methods=== | ===Evaluation Methods=== | ||
* [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
Line 55: | Line 58: | ||
*'''Institution''': Embrapa Clima Temperado, Rodovia BR 396, Km 78 Caixa Postal 403, CEP 96001-970 Pelotas, RS, Brazil | *'''Institution''': Embrapa Clima Temperado, Rodovia BR 396, Km 78 Caixa Postal 403, CEP 96001-970 Pelotas, RS, Brazil | ||
− | ==Citation Statistics== | + | ===Citation Statistics=== |
− | Cited by '''0''' (Based on Google Scholar [2017- | + | Cited by [https://scholar.google.com/scholar?cites=15247377201972822122&as_sdt=2005&sciodt=0,5&hl=en '''26'''] (Based on Google Scholar [2017-09-01]) |
+ | |||
+ | =='''''Different Developmental Stages & Tissues'''''== | ||
+ | ===Internal Control Genes=== | ||
+ | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
+ | |- | ||
+ | ! Gene Symbol | ||
+ | ! Gene Name | ||
+ | ! style="width=25% font-size:9pt "|Application Scope | ||
+ | ! Accession Number | ||
+ | ! Primers (5'-3')<br>[Forward/Reverse] | ||
+ | ! Size [bp] | ||
+ | ! Tm [℃] | ||
+ | ! Detection | ||
+ | |- | ||
+ | |align="center"| FaRIB413<ref name="ref3"/> | ||
+ | |align="center"| RNA interspacer (16S–23S) region | ||
+ | | | ||
+ | *Different tissues | ||
+ | *Strawberry cultivars | ||
+ | *Biotic stresses | ||
+ | *Ripening and senescent conditions | ||
+ | *SA/JA treatments | ||
+ | |align="center"| gene33863 (Fragaria vesca orthologe (a)) | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:ACCGTTGATTCGCACAATTGGTCATCG | ||
+ | * R:TACTGCGGGTCGGCAATCGGACG | ||
+ | |align="center"| 149 | ||
+ | |align="center"| 65 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| FaACTIN<ref name="ref3"/> | ||
+ | |align="center"| Actin | ||
+ | | | ||
+ | *Different tissues | ||
+ | *Strawberry cultivars | ||
+ | *Biotic stresses | ||
+ | *Ripening and senescent conditions | ||
+ | *SA/JA treatments | ||
+ | |align="center"| Actin (Fragaria vesca orthologe (a)) | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:GGGCCAGAAAGATGCTTATGTCGG | ||
+ | * R:GGGCAACACGAAGCTCATTGTAGAAG | ||
+ | |align="center"| 152 | ||
+ | |align="center"| 65 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| FaEF1α<ref name="ref3"/> | ||
+ | |align="center"| Elongation factor 1-alpha | ||
+ | | | ||
+ | *Different tissues | ||
+ | *Strawberry cultivars | ||
+ | *Biotic stresses | ||
+ | *Ripening and senescent conditions | ||
+ | *SA/JA treatments | ||
+ | |align="center"| gene28639, gene28622,gene23217(Fragaria vesca orthologe (a)) | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:TGGATTTGAGGGTGACAACATGA | ||
+ | * R:GTATACATCCTGAAGTGGTAGACGGAGG | ||
+ | |align="center"| 145 | ||
+ | |align="center"| 65 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| FaGAPDH2<ref name="ref3"/> | ||
+ | |align="center"| Glyceraldehyde-3-phosphate dehydrogenase | ||
+ | | | ||
+ | *Different tissues | ||
+ | *Strawberry cultivars | ||
+ | *Biotic stresses | ||
+ | *Ripening and senescent conditions | ||
+ | *SA/JA treatments | ||
+ | |align="center"| gene07104 (Fragaria vesca orthologe (a)) | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CCCAAGTAAGGATGCCCCCATGTTCG | ||
+ | * R:TTGGCAAGGGGAGCAAGACAGTTGGTAG | ||
+ | |align="center"| 117 | ||
+ | |align="center"| 65 | ||
+ | |align="center"| SYBR | ||
+ | |} | ||
+ | ===Molecular Types=== | ||
+ | *mRNA | ||
+ | |||
+ | ===Evaluation Methods=== | ||
+ | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
+ | * [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference'''] | ||
+ | * [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference'''] | ||
+ | ===Contact=== | ||
+ | *'''Name''': Jose´ L. Caballero | ||
+ | *'''Email''': bb1carej@uco.es | ||
+ | *'''Institution''': Departamento de Bioquı ´mica y Biologı ´a Molecular e Instituto Andaluz de Biotecnologı ´a, Campus Universitario de Rabanales y Campus de Excelencia Internacional Agroalimentario-CEIA3, Universidad de Co´rdoba, Co´rdoba, Andalucı ´a, Spain | ||
+ | ===Citation Statistics=== | ||
+ | Cited by [https://scholar.google.com/scholar?cites=11135432604107466419&as_sdt=2005&sciodt=0,5&hl=en '''35'''] (Based on Google Scholar [2017-09-01]) | ||
=='''References'''== | =='''References'''== | ||
<references> | <references> | ||
<ref name="ref1"> | <ref name="ref1"> | ||
+ | Galli V, Borowski JM, Perin EC, et al. (2015) Validation of reference genes for accurate normalization of gene expression for real time-quantitative PCR in strawberry fruits using different cultivars and osmotic stresses. Gene 554, 205-214. | ||
+ | </ref> | ||
+ | <ref name="ref2"> | ||
Arend GD, Adorno WT, Rezzadori K, et al. (2017) Concentration of phenolic compounds from strawberry (Fragaria X ananassa Duch) juice by nanofiltration membrane. Journal of Food Engineering 201, 36-41. | Arend GD, Adorno WT, Rezzadori K, et al. (2017) Concentration of phenolic compounds from strawberry (Fragaria X ananassa Duch) juice by nanofiltration membrane. Journal of Food Engineering 201, 36-41. | ||
</ref> | </ref> | ||
− | <ref name=" | + | <ref name="ref3"> |
− | + | Amil-Ruiz, Francisco, et al. Identification and validation of reference genes for transcript normalization in strawberry (Fragaria× ananassa) defense responses. PloS one 8.8 (2013): e70603. | |
</ref> | </ref> | ||
</references> | </references> | ||
+ | =='''Categories'''== | ||
[[Category:Plants]] | [[Category:Plants]] | ||
+ | [[Category:mRNA]][[Category:SYBR]] | ||
+ | [[Category:DBP]] [[Category:Histone]] [[Category:Osmotic Stress]] [[Category:Different Cultivars]] | ||
+ | [[Category:Different Developmental Stages]] [[Category:Different Tissues]] | ||
+ | [[Category:ACT]] [[Category:GAPDH]] [[Category:EF1α]] [[Category:RIB]] | ||
+ | [[Category:geNorm]] | ||
+ | [[Category:NormFinder]] | ||
+ | [[Category:BestKeeper]] | ||
+ | [[Category:Delta Ct]] | ||
+ | [[Category:RefFinder]] |
Latest revision as of 07:22, 1 September 2017
Contents
Description
- Fragaria ananassa Duch is one of the most economically important fruit crops worldwide. The increasing cultivation areas and the rising consumption of strawberry fruits are associated with their sensorial characteristics such as pleasant flavor, taste and texture, as well as with their essential nutrients, minerals, vitamins, and antioxidant compounds. The antioxidant properties of strawberry fruits are related to the high content of L-ascorbic acid (vitamin C), anthocyanins and phenolic compounds, which have been medically recognized as having positive influences on protecting against the risk of many diseases[1][2].
- Common Name: Garden strawberry,Strawberry
- NCBI Taxonomy
Different Cultivars & Osmotic Stress
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
DBP[1] | DNA binding protein |
|
EU727547 |
|
NA | 79.54 | SYBR |
HISTH4[1] | Histone H4 |
|
AB197150.1 |
|
167 | 88.27 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
- Ref-Finder method && Related Reference
- ΔCt approach method && Related Reference
Contact
- Name: Vanessa Galli
- Email: vane.galli@yahoo.com.br
- Institution: Embrapa Clima Temperado, Rodovia BR 396, Km 78 Caixa Postal 403, CEP 96001-970 Pelotas, RS, Brazil
Citation Statistics
Cited by 26 (Based on Google Scholar [2017-09-01])
Different Developmental Stages & Tissues
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
FaRIB413[3] | RNA interspacer (16S–23S) region |
|
gene33863 (Fragaria vesca orthologe (a)) |
|
149 | 65 | SYBR |
FaACTIN[3] | Actin |
|
Actin (Fragaria vesca orthologe (a)) |
|
152 | 65 | SYBR |
FaEF1α[3] | Elongation factor 1-alpha |
|
gene28639, gene28622,gene23217(Fragaria vesca orthologe (a)) |
|
145 | 65 | SYBR |
FaGAPDH2[3] | Glyceraldehyde-3-phosphate dehydrogenase |
|
gene07104 (Fragaria vesca orthologe (a)) |
|
117 | 65 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Jose´ L. Caballero
- Email: bb1carej@uco.es
- Institution: Departamento de Bioquı ´mica y Biologı ´a Molecular e Instituto Andaluz de Biotecnologı ´a, Campus Universitario de Rabanales y Campus de Excelencia Internacional Agroalimentario-CEIA3, Universidad de Co´rdoba, Co´rdoba, Andalucı ´a, Spain
Citation Statistics
Cited by 35 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 1.2 Galli V, Borowski JM, Perin EC, et al. (2015) Validation of reference genes for accurate normalization of gene expression for real time-quantitative PCR in strawberry fruits using different cultivars and osmotic stresses. Gene 554, 205-214.
- ↑ Arend GD, Adorno WT, Rezzadori K, et al. (2017) Concentration of phenolic compounds from strawberry (Fragaria X ananassa Duch) juice by nanofiltration membrane. Journal of Food Engineering 201, 36-41.
- ↑ 3.0 3.1 3.2 3.3 Amil-Ruiz, Francisco, et al. Identification and validation of reference genes for transcript normalization in strawberry (Fragaria× ananassa) defense responses. PloS one 8.8 (2013): e70603.