Difference between revisions of "Fragaria ananassa"
Jump to navigation
Jump to search
ICG Expert4 (talk | contribs) |
|||
Line 26: | Line 26: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:TTGGCAGCGGGACTTTACC | * F:TTGGCAGCGGGACTTTACC | ||
− | * R: | + | * R:CGGTTGTGTGACGCTGTCAT |
|align="center"| NA | |align="center"| NA | ||
|align="center"| 79.54 | |align="center"| 79.54 | ||
Line 38: | Line 38: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:GTGGCGTCAAGCGTATCTCC | * F:GTGGCGTCAAGCGTATCTCC | ||
− | * R: | + | * R:TGTCCTTCCCTGCCTCTTGA |
|align="center"| 167 | |align="center"| 167 | ||
|align="center"| 88.27 | |align="center"| 88.27 |
Revision as of 02:21, 23 June 2017
Contents
Description
- Strawberry (Fragaria × ananassa Duch) is one of the most economically important fruit crops worldwide. The increasing cultivation areas and the rising consumption of strawberry fruits are associated with its pleasant flavor, taste and texture, as well as with their essential nutrients, minerals, vitamins, and antioxidant compounds. The antioxidant properties of strawberry fruits are related to the high content of L-ascorbic acid (vitamin C), anthocyanins and phenolic compounds, which have been medically recognized as having positive influences on protecting against the risk of many diseases.
- The increasing demand of strawberry (Fragaria × ananassa Duch) fruits is associated mainly with their sensorial characteristics and the content of antioxidant compounds.[1] [2].
- Common Name: Garden strawberry
- NCBI Taxonomy
Different Cultivars & Osmotic Stress
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
DBP[1] | DNA binding protein |
|
EU727547 |
|
NA | 79.54 | SYBR |
HISTH4[1] | mRNA for histone H4, partial cds |
|
AB197150.1 |
|
167 | 88.27 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
- Ref-Finder method && Related Reference
- ΔCt approach method && Related Reference
Contact
- Name: Vanessa Galli
- Email: vane.galli@yahoo.com.br
- Institution: Embrapa Clima Temperado, Rodovia BR 396, Km 78 Caixa Postal 403, CEP 96001-970 Pelotas, RS, Brazil
Citation Statistics
Cited by 0 (Based on Google Scholar [2017-06-01])
References
- ↑ 1.0 1.1 1.2 Galli V, Borowski JM, Perin EC, et al. (2015) Validation of reference genes for accurate normalization of gene expression for real time-quantitative PCR in strawberry fruits using different cultivars and osmotic stresses. Gene 554, 205-214.
- ↑ Arend GD, Adorno WT, Rezzadori K, et al. (2017) Concentration of phenolic compounds from strawberry (Fragaria X ananassa Duch) juice by nanofiltration membrane. Journal of Food Engineering 201, 36-41.