Difference between revisions of "Fragaria ananassa"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
==Description==
 
==Description==
 
[[File:Fragaria ananassa.png|right|200px|]]
 
[[File:Fragaria ananassa.png|right|200px|]]
* '''''Fragaria × ananassa Duch''''' is one of the most economically important fruit crops worldwide. The increasing cultivation areas and the rising consumption of strawberry fruits are associated with their sensorial characteristics such as pleasant flavor, taste and texture, as well as with their essential nutrients, minerals, vitamins, and antioxidant compounds. The antioxidant properties of strawberry fruits are related to the high content of L-ascorbic acid (vitamin C), anthocyanins and phenolic compounds, which have been medically recognized as having positive influences on protecting against the risk of many diseases<ref name="ref1"/> <ref name="ref2"/>.
+
* '''''Fragaria ananassa''''' is one of the most economically important fruit crops worldwide. The increasing cultivation areas and the rising consumption of strawberry fruits are associated with their sensorial characteristics such as pleasant flavor, taste and texture, as well as with their essential nutrients, minerals, vitamins, and antioxidant compounds. The antioxidant properties of strawberry fruits are related to the high content of L-ascorbic acid (vitamin C), anthocyanins and phenolic compounds, which have been medically recognized as having positive influences on protecting against the risk of many diseases<ref name="ref1"/> <ref name="ref2"/>.
 
* <font color=blue>'''Common Name:'''</font> '''Garden strawberry''','''Strawberry'''
 
* <font color=blue>'''Common Name:'''</font> '''Garden strawberry''','''Strawberry'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3747 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3747 <font color=blue>'''NCBI Taxonomy'''</font>]

Revision as of 01:43, 29 June 2017

Description

Fragaria ananassa.png
  • Fragaria ananassa is one of the most economically important fruit crops worldwide. The increasing cultivation areas and the rising consumption of strawberry fruits are associated with their sensorial characteristics such as pleasant flavor, taste and texture, as well as with their essential nutrients, minerals, vitamins, and antioxidant compounds. The antioxidant properties of strawberry fruits are related to the high content of L-ascorbic acid (vitamin C), anthocyanins and phenolic compounds, which have been medically recognized as having positive influences on protecting against the risk of many diseases[1] [2].
  • Common Name: Garden strawberry,Strawberry
  • NCBI Taxonomy

Different Cultivars & Osmotic Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
DBP[1] DNA binding protein
  • Drought stress
EU727547
  • F:TTGGCAGCGGGACTTTACC
  • R:CGGTTGTGTGACGCTGTCAT
NA 79.54 SYBR
HISTH4[1] Histone H4
  • Osmotic stress
  • Salt stress
AB197150.1
  • F:GTGGCGTCAAGCGTATCTCC
  • R:TGTCCTTCCCTGCCTCTTGA
167 88.27 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Vanessa Galli
  • Email: vane.galli@yahoo.com.br
  • Institution: Embrapa Clima Temperado, Rodovia BR 396, Km 78 Caixa Postal 403, CEP 96001-970 Pelotas, RS, Brazil

Citation Statistics

Cited by 0 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 Galli V, Borowski JM, Perin EC, et al. (2015) Validation of reference genes for accurate normalization of gene expression for real time-quantitative PCR in strawberry fruits using different cultivars and osmotic stresses. Gene 554, 205-214.
  2. Arend GD, Adorno WT, Rezzadori K, et al. (2017) Concentration of phenolic compounds from strawberry (Fragaria X ananassa Duch) juice by nanofiltration membrane. Journal of Food Engineering 201, 36-41.