Difference between revisions of "Francisella noatunensis"

From ICG
Jump to navigation Jump to search
Line 87: Line 87:
 
</references>
 
</references>
 
[[Category:Bacteria]] [[Category:mRNA]] [[Category:SYBR]]
 
[[Category:Bacteria]] [[Category:mRNA]] [[Category:SYBR]]
 +
[[Category:CDP]] [[Category:fopA]] [[Category:polA]]

Revision as of 08:54, 19 June 2017

Description

Francisella noatunensis-1.gif
  • Systemic infection caused by the Gram-negative bacterium Francisella noatunensis remains a serious threat to Atlantic cod Gadhus morhua L. farming in Norway. Similar diseases associated with different strains of F. noatunensis have been reported in both fresh- and seawater farmed fish in Taiwan and Japan Chile, America, and Great Britain. Large knowledge gaps exist, however, in relation to pathogenesis and mechanisms of disease development[1] [2] [3] [4] [5].

Different Growth Conditions

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
fopA[1] Francisella outer membrane protein A
  • Universal reference gene
12952182
  • F:TACTGGTGCATGGGATGTTG
  • R:TACTGGTGCATGGGATGTTG
100 60 SYBR
ftsZ[1] Cell division protein
  • Universal reference gene
12952792
  • F:TACCATACTCAGCGGCTTTC
  • R:GCGCCTGTAGTTGCTGAAGT
112 60 SYBR
polA[1] DNA polymerase I
  • Universal reference gene
12951484
  • F:AGCTGGAACTGGTCGTAATCA
  • R:ATCAGCATCTTCAGCAGCATA
82 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Samuel Duodu
  • Email: samuel.duodu@vetinst.no
  • Institution: Section for Microbiology, Immunology and Parasitology, Department of Food Safety and Infection Biology, Norwegian School of Veterinary Science, PO Box 8146 Dep, Oslo 0033, Norway

Citation Statistics

Cited by 13 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Brudal E, Winther-Larsen H C, Colquhoun D J, et al. Evaluation of reference genes for reverse transcription quantitative PCR analyses of fish-pathogenic Francisella strains exposed to different growth conditions[J]. BMC research notes, 2013, 6(1): 76.
  2. Kamaishi T, Fukuda Y, Nishiyama M, Kawakami M, Matsuyama T, Yoshinaga T, Oseko N: Identification and pathogenicity of intracellular Francisella bacterium in three-line grunt Parapristipoma trilineatum. Fish Pathology 2005, 40:67–71.
  3. Birkbeck TH, Bordevik M, Frøystad MK, Baklien A: Identification of Francisella sp. from Atlantic salmon, Salmo salar L., in Chile. J Fish Dis 2007, 30:505–507.
  4. Mauel MJ, Soto E, Moralis JA, Hawke J: A piscirickettsiosis-like syndrome in cultured Nile tilapia in Latin America with Francisella spp. as the pathogenic agent. J Aquat Anim Health 2007, 19:27–34.
  5. Jeffery KR, Stone D, Feist SW, Verner-Jeffreys DW: An outbreak of disease caused by Francisella sp. in Nile tilapia Oreochromis niloticus at a recirculation fish farm in the UK. Dis Aquat Organ 2010, 91:161–165.