Difference between revisions of "Gadus morhua"

From ICG
Jump to navigation Jump to search
 
(11 intermediate revisions by 4 users not shown)
Line 1: Line 1:
==Description==
+
=='''Description'''==
[[File:REFqPCR200805.jpg|right|227px|]]
+
[[File:Gadus morhua.png|right|200px|link=Gadus morhua]]
* The Atlantic cod (Gadus morhua) is confined to the North Atlantic Ocean where it inhabits benthopelagic environments at continental shelves and banks from Atlantic Canada to Northern Europe.  
+
* '''''Gadus morhua''''' is confined to the North Atlantic Ocean where it inhabits benthopelagic environments at continental shelves and banks from Atlantic Canada to Northern Europe. It is of great economical value and has historically been a major contributor to the cultural identity of people living in the coastal areas<ref name="ref1"/><ref name="ref2"/>.
* Atlantic cod is of great economical value and has historically been a major contributor to the cultural identity of people living in the coastal areas.<ref name="ref1"/> <ref name="ref2"/>.
 
 
* <font color=blue>'''Common Name:'''</font> '''Atlantic cod'''
 
* <font color=blue>'''Common Name:'''</font> '''Atlantic cod'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=8049 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=8049 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Tissues'''''==
 
=='''''Different Tissues'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 22: Line 21:
 
|align="center"| Ubiquitin  
 
|align="center"| Ubiquitin  
 
|
 
|
* Universal reference gene
+
* Gills, brain, liver, head kidney, muscle and middle intestine
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/EX735613 '''EX735613''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/EX735613 '''EX735613''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 34: Line 33:
 
|align="center"| Acidic ribosomal protein
 
|align="center"| Acidic ribosomal protein
 
|
 
|
* Universal reference gene
+
* Gills, brain, liver, head kidney, muscle and middle intestine
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/EX741373 '''EX741373''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/EX741373 '''EX741373''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 57: Line 56:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''80''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=13011552482621235517&as_sdt=2005&sciodt=0,5&hl=en '''82'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 68: Line 67:
 
</ref>
 
</ref>
 
</references>
 
</references>
 
+
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
 
[[Category:mRNA]]
 
[[Category:mRNA]]
Line 75: Line 74:
 
[[Category:ARP]] [[Category:Ubiquitin]]
 
[[Category:ARP]] [[Category:Ubiquitin]]
 
[[Category:Different Tissues]]
 
[[Category:Different Tissues]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]

Latest revision as of 07:33, 1 September 2017

Description

Gadus morhua.png
  • Gadus morhua is confined to the North Atlantic Ocean where it inhabits benthopelagic environments at continental shelves and banks from Atlantic Canada to Northern Europe. It is of great economical value and has historically been a major contributor to the cultural identity of people living in the coastal areas[1][2].
  • Common Name: Atlantic cod
  • NCBI Taxonomy

Different Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Ubi[1] Ubiquitin
  • Gills, brain, liver, head kidney, muscle and middle intestine
EX735613
  • F:GGCCGCAAAGATGCAGAT
  • R:CTGGGCTCGACCTCAAGAGT
69 bp 60 SYBR
ARP[1] Acidic ribosomal protein
  • Gills, brain, liver, head kidney, muscle and middle intestine
EX741373
  • F:TGATCCTCCACGACGATGAG
  • R:CAGGGCCTTGGCGAAGA
113 bp 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Pål A Olsvik
  • Email: pal.olsvik@nifes.no
  • Institution: National Institute of Nutrition and Seafood Research, Nordnesboder 2, N-5005 Bergen, Norway

Citation Statistics

Cited by 82 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Olsvik P A, Søfteland L, Lie K K. Selection of reference genes for qRT-PCR examination of wild populations of Atlantic cod Gadus morhua[J]. BMC Research Notes, 2008, 1(1): 47.
  2. Johansen S D, Coucheron D H, Andreassen M, et al. Large-scale sequence analyses of Atlantic cod[J]. New Biotechnology, 2009, 25(5): 263-271.

Categories