Difference between revisions of "Gadus morhua"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
[[File:Gadus morhua.png|right|200px|]]
 
[[File:Gadus morhua.png|right|200px|]]
* The Atlantic cod (Gadus morhua) is confined to the North Atlantic Ocean where it inhabits benthopelagic environments at continental shelves and banks from Atlantic Canada to Northern Europe.  
+
* '''''Gadus morhua''''' is confined to the North Atlantic Ocean where it inhabits benthopelagic environments at continental shelves and banks from Atlantic Canada to Northern Europe. It is of great economical value and has historically been a major contributor to the cultural identity of people living in the coastal areas<ref name=""ref1""/><ref name=""ref2""/>. "
* Atlantic cod is of great economical value and has historically been a major contributor to the cultural identity of people living in the coastal areas.<ref name="ref1"/> <ref name="ref2"/>.
 
 
* <font color=blue>'''Common Name:'''</font> '''Atlantic cod'''
 
* <font color=blue>'''Common Name:'''</font> '''Atlantic cod'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=8049 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=8049 <font color=blue>'''NCBI Taxonomy'''</font>]

Revision as of 12:03, 28 June 2017

Description

Gadus morhua.png
  • Gadus morhua is confined to the North Atlantic Ocean where it inhabits benthopelagic environments at continental shelves and banks from Atlantic Canada to Northern Europe. It is of great economical value and has historically been a major contributor to the cultural identity of people living in the coastal areas[1][1]. "
  • Common Name: Atlantic cod
  • NCBI Taxonomy

Different Tissues

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Ubi[2] Ubiquitin
  • Universal reference gene
EX735613
  • F:GGCCGCAAAGATGCAGAT
  • R:CTGGGCTCGACCTCAAGAGT
69 bp 60 SYBR
ARP[2] Acidic ribosomal protein
  • Universal reference gene
EX741373
  • F:TGATCCTCCACGACGATGAG
  • R:CAGGGCCTTGGCGAAGA
113 bp 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Pål A Olsvik
  • Email: pal.olsvik@nifes.no
  • Institution: National Institute of Nutrition and Seafood Research, Nordnesboder 2, N-5005 Bergen, Norway

Citation Statistics

Cited by 80 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 Cite error: Invalid <ref> tag; no text was provided for refs named
  2. 2.0 2.1 Olsvik P A, Søfteland L, Lie K K. Selection of reference genes for qRT-PCR examination of wild populations of Atlantic cod Gadus morhua[J]. BMC Research Notes, 2008, 1(1): 47.

Cite error: <ref> tag with name "ref2" defined in <references> is not used in prior text.