Difference between revisions of "Gadus morhua"

From ICG
Jump to navigation Jump to search
Line 12: Line 12:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]

Revision as of 12:18, 20 June 2017

Description

REFqPCR200805.jpg
  • The Atlantic cod (Gadus morhua) is confined to the North Atlantic Ocean where it inhabits benthopelagic environments at continental shelves and banks from Atlantic Canada to Northern Europe.
  • Atlantic cod is of great economical value and has historically been a major contributor to the cultural identity of people living in the coastal areas.[1] [2].

Different Tissues

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Ubi[1] Ubiquitin
  • Universal reference gene
EX735613
  • F:GGCCGCAAAGATGCAGAT
  • R:CTGGGCTCGACCTCAAGAGT
69 bp 60 SYBR
ARP[1] Acidic ribosomal protein
  • Universal reference gene
EX741373
  • F:TGATCCTCCACGACGATGAG
  • R:CAGGGCCTTGGCGAAGA
113 bp 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Pål A Olsvik
  • Email: pal.olsvik@nifes.no
  • Institution: National Institute of Nutrition and Seafood Research, Nordnesboder 2, N-5005 Bergen, Norway

Citation Statistics

Cited by 80 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 Olsvik P A, Søfteland L, Lie K K. Selection of reference genes for qRT-PCR examination of wild populations of Atlantic cod Gadus morhua[J]. BMC Research Notes, 2008, 1(1): 47.
  2. Johansen S D, Coucheron D H, Andreassen M, et al. Large-scale sequence analyses of Atlantic cod[J]. New Biotechnology, 2009, 25(5): 263-271.