Difference between revisions of "Gadus morhua"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
==Description==
+
=='''Description'''==
 
[[File:REFqPCR200805.jpg|right|227px|]]
 
[[File:REFqPCR200805.jpg|right|227px|]]
 
* The Atlantic cod (Gadus morhua) is confined to the North Atlantic Ocean where it inhabits benthopelagic environments at continental shelves and banks from Atlantic Canada to Northern Europe.  
 
* The Atlantic cod (Gadus morhua) is confined to the North Atlantic Ocean where it inhabits benthopelagic environments at continental shelves and banks from Atlantic Canada to Northern Europe.  

Revision as of 04:55, 26 June 2017

Description

REFqPCR200805.jpg
  • The Atlantic cod (Gadus morhua) is confined to the North Atlantic Ocean where it inhabits benthopelagic environments at continental shelves and banks from Atlantic Canada to Northern Europe.
  • Atlantic cod is of great economical value and has historically been a major contributor to the cultural identity of people living in the coastal areas.[1] [2].
  • Common Name: Atlantic cod
  • NCBI Taxonomy

Different Tissues

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Ubi[1] Ubiquitin
  • Universal reference gene
EX735613
  • F:GGCCGCAAAGATGCAGAT
  • R:CTGGGCTCGACCTCAAGAGT
69 bp 60 SYBR
ARP[1] Acidic ribosomal protein
  • Universal reference gene
EX741373
  • F:TGATCCTCCACGACGATGAG
  • R:CAGGGCCTTGGCGAAGA
113 bp 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Pål A Olsvik
  • Email: pal.olsvik@nifes.no
  • Institution: National Institute of Nutrition and Seafood Research, Nordnesboder 2, N-5005 Bergen, Norway

Citation Statistics

Cited by 80 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 Olsvik P A, Søfteland L, Lie K K. Selection of reference genes for qRT-PCR examination of wild populations of Atlantic cod Gadus morhua[J]. BMC Research Notes, 2008, 1(1): 47.
  2. Johansen S D, Coucheron D H, Andreassen M, et al. Large-scale sequence analyses of Atlantic cod[J]. New Biotechnology, 2009, 25(5): 263-271.