Difference between revisions of "Gadus morhua"

Revision as of 04:55, 26 June 2017

The Atlantic cod (Gadus morhua) is confined to the North Atlantic Ocean where it inhabits benthopelagic environments at continental shelves and banks from Atlantic Canada to Northern Europe.
Atlantic cod is of great economical value and has historically been a major contributor to the cultural identity of people living in the coastal areas.^[1] ^[2].
Common Name: Atlantic cod
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
Ubi^[1]	Ubiquitin	Universal reference gene	EX735613	F:GGCCGCAAAGATGCAGAT R:CTGGGCTCGACCTCAAGAGT	69 bp	60	SYBR
ARP^[1]	Acidic ribosomal protein	Universal reference gene	EX741373	F:TGATCCTCCACGACGATGAG R:CAGGGCCTTGGCGAAGA	113 bp	60	SYBR

Name: Pål A Olsvik
Email: pal.olsvik@nifes.no
Institution: National Institute of Nutrition and Seafood Research, Nordnesboder 2, N-5005 Bergen, Norway

Cited by 80 (Based on Google Scholar [2017-06-01])

↑ ^1.0 ^1.1 ^1.2 Olsvik P A, Søfteland L, Lie K K. Selection of reference genes for qRT-PCR examination of wild populations of Atlantic cod Gadus morhua[J]. BMC Research Notes, 2008, 1(1): 47.
↑ Johansen S D, Coucheron D H, Andreassen M, et al. Large-scale sequence analyses of Atlantic cod[J]. New Biotechnology, 2009, 25(5): 263-271.

@@ Line 1: / Line 1: @@
-==Description==
+=='''Description'''==
 [[File:REFqPCR200805.jpg|right|227px|]]
 * The Atlantic cod (Gadus morhua) is confined to the North Atlantic Ocean where it inhabits benthopelagic environments at continental shelves and banks from Atlantic Canada to Northern Europe.