Difference between revisions of "Gallus gallus"
Jump to navigation
Jump to search
ICG Expert1 (talk | contribs) |
|||
Line 25: | Line 25: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:AGCTCTGGGATAGTGCCACAG | * F:AGCTCTGGGATAGTGCCACAG | ||
− | * R: | + | * R:ATAATAACAGCAGCAAAACGCTTG |
|align="center"| 134 | |align="center"| 134 | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 37: | Line 37: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:GAAGGCTGGGGCTCATCTG | * F:GAAGGCTGGGGCTCATCTG | ||
− | * R: | + | * R:CAGTTGGTGGTGCACGATG |
|align="center"| 150 | |align="center"| 150 | ||
|align="center"| 60 | |align="center"| 60 | ||
Line 49: | Line 49: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:GGCGAAGCCAGAGGAAACT | * F:GGCGAAGCCAGAGGAAACT | ||
− | * R: | + | * R:GACGACCGATTTGCACGTC |
|align="center"| 62 | |align="center"| 62 | ||
|align="center"| 60 | |align="center"| 60 |
Revision as of 01:41, 23 June 2017
Contents
Description
- Gallus gallus is a tropical member of the family Phasianidae, it is the primary progenitor of the domestic chicken. The red junglefowl was first domesticated at least five thousand years ago in Asia. Since then it has spread around the world, and the domestic form is kept globally as a productive food source of both meat and eggs. Gallus gallus is an important model organism that bridges the evolutionary gap between mammals and other vertebrates and serves as the main laboratory model for the approximately 9,600 extant avian species [1] [2].
- Common Name: Red junglefowl
- NCBI Taxonomy
Lymphoid Organs
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
TBP[1] | TA-TA binding protein 1 mRNA, partial cds |
|
AF221563 |
|
134 | 60 | SYBR |
GAPDH[1] | Glyceraldehyde-3-phosphate dehydrogenase mRNA,complete cds. |
|
AF047874 |
|
150 | 60 | SYBR |
r28S[1] | 28S rRNA gene, clone GgLSU-1. |
|
FM165415 |
|
62 | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: D. Borowska
- Email: dominika.borowska@roslin.ed.ac.uk
- Institution: The Roslin Institute and R(D)SVS, University of Edinburgh, Easter Bush, Midlothian EH25 9RG, United Kingdom
Citation Statistics
Cited by 5 (Based on Google Scholar [2017-06-01])
Embryo Fibroblasts
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
ACTB[2] | Beta-actin |
|
L08165 |
|
183 | NA | SYBR |
HPRT1[2] | Hypoxanthine phosphorribosyltransferase 1 |
|
NM_204848 |
|
177 | NA | SYBR |
HMBS[2] | Hydroxymethylbilane synthase |
|
XM_417846 |
|
131 | NA | SYBR |
Molecular types
- mRNA
Evaluation Methods
- ΔCt approach method && Related Reference
Contact
- Name: Zhuang Ding
- Email: renfu.yin@helmholtz-muenchen.de
- Institution: Department of Veterinary Preventive Medicine, College of Animal Science and Veterinary Medicine, Jilin University, Xi’an Road 5333, Changchun, Jilin 130062, China
Citation Statistics
Cited by 14 (Based on Google Scholar [2017-06-01])
References
- ↑ 1.0 1.1 1.2 1.3 Borowska D, Rothwell L, Bailey RA, Watson K, Kaiser P (2016) Identification of stable reference genes for quantitative PCR in cells derived from chicken lymphoid organs. Vet Immunol Immunopathol 170, 20-24.
- ↑ 2.0 2.1 2.2 2.3 Yin R, Liu X, Liu C, et al. Systematic selection of housekeeping genes for gene expression normalization in chicken embryo fibroblasts infected with Newcastle disease virus[J]. Biochemical and biophysical research communications, 2011, 413(4): 537-540.