Difference between revisions of "Gallus gallus"

From ICG
Jump to navigation Jump to search
(Created page with "==Description== right|227px| * "Gallus gallus" redirects here. For other subspecies, see Chicken. The red junglefowl (Gallus gallus) is a tropica...")
 
Line 64: Line 64:
 
*'''Email''': dominika.borowska@roslin.ed.ac.uk
 
*'''Email''': dominika.borowska@roslin.ed.ac.uk
 
*'''Institution''': The Roslin Institute and R(D)SVS, University of Edinburgh, Easter Bush, Midlothian EH25 9RG, United Kingdom
 
*'''Institution''': The Roslin Institute and R(D)SVS, University of Edinburgh, Easter Bush, Midlothian EH25 9RG, United Kingdom
 +
 +
==Citation Statistics==
 +
Cited by '''5''' (Based on Google Scholar [2017-06-01])
  
 
=='''References'''==
 
=='''References'''==
Line 74: Line 77:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
[[Category:Animals]]

Revision as of 09:49, 16 June 2017

Description

REFqPCR2016011-1.jpg
  • "Gallus gallus" redirects here. For other subspecies, see Chicken. The red junglefowl (Gallus gallus) is a tropical member of the family Phasianidae. It is the primary progenitor of the domestic chicken (though genetic evidence strongly suggests some past hybridisation with the grey junglefowl as well). The red junglefowl was first domesticated at least five thousand years ago in Asia. Since then it has spread around the world, and the domestic form is kept globally as a very productive food source of both meat and eggs.
  • The chicken (Gallus gallus) is an important model organism that bridges the evolutionary gap between mammals and other vertebrates and serves as the main laboratory model for the approx9,600 extant avian species. The chicken also represents the first agricultural animal to have its genome sequenced. Modern birds (Ornithurae) evolved from therapod dinosaurs9, 10 in the middle of the Mesozoic era. [1] [2].

Lymphoid Organs

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
TBP[1] TA-TA binding protein 1 mRNA, partial cds
  • Chicken lymphoid organs
AF221563
  • F:AGCTCTGGGATAGTGCCACAG
  • R:AGCTCTGGGATAGTGCCACAG
134 60 SYBR
GAPDH[1] glyceraldehyde-3-phosphate dehydrogenase mRNA,complete cds.
  • Chicken lymphoid organs
AF047874
  • F:GAAGGCTGGGGCTCATCTG
  • R:GAAGGCTGGGGCTCATCTG
150 60 SYBR
r28S[1] 28S rRNA gene, clone GgLSU-1.
  • Chicken lymphoid organs
FM165415
  • F:GGCGAAGCCAGAGGAAACT
  • R:GGCGAAGCCAGAGGAAACT
62 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: D. Borowska
  • Email: dominika.borowska@roslin.ed.ac.uk
  • Institution: The Roslin Institute and R(D)SVS, University of Edinburgh, Easter Bush, Midlothian EH25 9RG, United Kingdom

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 Borowska D, Rothwell L, Bailey RA, Watson K, Kaiser P (2016) Identification of stable reference genes for quantitative PCR in cells derived from chicken lymphoid organs. Vet Immunol Immunopathol 170, 20-24.
  2. Hillier LW, Miller W, Birney E, et al. (2004) Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. Nature 432, 695-716.