Difference between revisions of "Gallus gallus"
Jump to navigation
Jump to search
ICG Expert4 (talk | contribs) |
|||
| Line 67: | Line 67: | ||
==Citation Statistics== | ==Citation Statistics== | ||
Cited by '''5''' (Based on Google Scholar [2017-06-01]) | Cited by '''5''' (Based on Google Scholar [2017-06-01]) | ||
| + | |||
| + | =='''''Embryo Fibroblasts'''''== | ||
| + | ===Reference Genes=== | ||
| + | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
| + | |- | ||
| + | ! Gene Symbol | ||
| + | ! Gene Name | ||
| + | ! style="width=25% font-size:9pt "|Application Scope | ||
| + | ! Accession Number | ||
| + | ! Primer | ||
| + | ! Size [bp] | ||
| + | ! Tm [℃] | ||
| + | ! Detection | ||
| + | |- | ||
| + | |align="center"| ACTB<ref name="ref1"/> | ||
| + | |align="center"| Beta-actin | ||
| + | | | ||
| + | in chicken embryo fibroblast following NDV treatment over a time up to 72 h | ||
| + | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/L08165.1 '''L08165'''] | ||
| + | |nowrap style="font-size:9pt"| | ||
| + | * F:cagacatcagggtgtgatgg | ||
| + | * R: tcaggggctactctcagctc | ||
| + | |align="center"| 183 | ||
| + | |align="center"| NA | ||
| + | |align="center"| SYBR | ||
| + | |- | ||
| + | |align="center"| HPRT1<ref name="ref1"/> | ||
| + | |align="center"| Hypoxanthine phosphorribosyltransferase 1 | ||
| + | | | ||
| + | in chicken embryo fibroblast following NDV treatment over a time up to 73 h | ||
| + | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_204848.1 '''NM_204848'''] | ||
| + | |nowrap style="font-size:9pt"| | ||
| + | * F: tggtggggatgacctctcaa | ||
| + | * R: ggccgatatcccacacttcg | ||
| + | |align="center"| 177 | ||
| + | |align="center"| NA | ||
| + | |align="center"| SYBR | ||
| + | |- | ||
| + | |align="center"| HMBS<ref name="ref1"/> | ||
| + | |align="center"| Hydroxymethylbilane synthase | ||
| + | | | ||
| + | in chicken embryo fibroblast following NDV treatment over a time up to 74 h | ||
| + | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_417846 '''XM_417846'''] | ||
| + | |nowrap style="font-size:9pt"| | ||
| + | * F: ggctgggagaatcgcatagg | ||
| + | * R: ggccgatatcccacacttcg | ||
| + | |align="center"| 131 | ||
| + | |align="center"| NA | ||
| + | |align="center"| SYBR | ||
| + | |} | ||
| + | ===Moleculer types=== | ||
| + | * mRNA | ||
| + | ===Evaluation Methods=== | ||
| + | * '''ΔCt approach method''' && [https://www.ncbi.nlm.nih.gov/pubmed/17026756 '''Related Reference'''] | ||
| + | ===Contact=== | ||
| + | *'''Name''': Zhuang Ding | ||
| + | *'''Email''': renfu.yin@helmholtz-muenchen.de | ||
| + | *'''Institute''': Department of Veterinary Preventive Medicine, College of Animal Science and Veterinary Medicine, Jilin University, Xi’an Road 5333, Changchun, Jilin 130062, China | ||
=='''References'''== | =='''References'''== | ||
Revision as of 14:33, 16 June 2017
Contents
Description
- "Gallus gallus" redirects here. For other subspecies, see Chicken. The red junglefowl (Gallus gallus) is a tropical member of the family Phasianidae. It is the primary progenitor of the domestic chicken (though genetic evidence strongly suggests some past hybridisation with the grey junglefowl as well). The red junglefowl was first domesticated at least five thousand years ago in Asia. Since then it has spread around the world, and the domestic form is kept globally as a very productive food source of both meat and eggs.
- The chicken (Gallus gallus) is an important model organism that bridges the evolutionary gap between mammals and other vertebrates and serves as the main laboratory model for the approx9,600 extant avian species. The chicken also represents the first agricultural animal to have its genome sequenced. Modern birds (Ornithurae) evolved from therapod dinosaurs9, 10 in the middle of the Mesozoic era. [1] [2].
Lymphoid Organs
Reference Genes
| Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
|---|---|---|---|---|---|---|---|
| TBP[1] | TA-TA binding protein 1 mRNA, partial cds |
|
AF221563 |
|
134 | 60 | SYBR |
| GAPDH[1] | glyceraldehyde-3-phosphate dehydrogenase mRNA,complete cds. |
|
AF047874 |
|
150 | 60 | SYBR |
| r28S[1] | 28S rRNA gene, clone GgLSU-1. |
|
FM165415 |
|
62 | 60 | SYBR |
Moleculer Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: D. Borowska
- Email: dominika.borowska@roslin.ed.ac.uk
- Institution: The Roslin Institute and R(D)SVS, University of Edinburgh, Easter Bush, Midlothian EH25 9RG, United Kingdom
Citation Statistics
Cited by 5 (Based on Google Scholar [2017-06-01])
Embryo Fibroblasts
Reference Genes
| Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
|---|---|---|---|---|---|---|---|
| ACTB[1] | Beta-actin |
in chicken embryo fibroblast following NDV treatment over a time up to 72 h |
L08165 |
|
183 | NA | SYBR |
| HPRT1[1] | Hypoxanthine phosphorribosyltransferase 1 |
in chicken embryo fibroblast following NDV treatment over a time up to 73 h |
NM_204848 |
|
177 | NA | SYBR |
| HMBS[1] | Hydroxymethylbilane synthase |
in chicken embryo fibroblast following NDV treatment over a time up to 74 h |
XM_417846 |
|
131 | NA | SYBR |
Moleculer types
- mRNA
Evaluation Methods
- ΔCt approach method && Related Reference
Contact
- Name: Zhuang Ding
- Email: renfu.yin@helmholtz-muenchen.de
- Institute: Department of Veterinary Preventive Medicine, College of Animal Science and Veterinary Medicine, Jilin University, Xi’an Road 5333, Changchun, Jilin 130062, China
References
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Borowska D, Rothwell L, Bailey RA, Watson K, Kaiser P (2016) Identification of stable reference genes for quantitative PCR in cells derived from chicken lymphoid organs. Vet Immunol Immunopathol 170, 20-24.
- ↑ Hillier LW, Miller W, Birney E, et al. (2004) Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. Nature 432, 695-716.
