Difference between revisions of "Gallus gallus"

From ICG
Jump to navigation Jump to search
 
(20 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:REFqPCR2016011-1.jpg|right|227px|]]
+
[[File:Gallus gallus.png|right|200px|link=Gallus gallus]]
* "Gallus gallus" redirects here. For other subspecies, see Chicken. The red junglefowl (Gallus gallus) is a tropical member of the family Phasianidae. It is the primary progenitor of the domestic chicken (though genetic evidence strongly suggests some past hybridisation with the grey junglefowl as well). The red junglefowl was first domesticated at least five thousand years ago in Asia. Since then it has spread around the world, and the domestic form is kept globally as a very productive food source of both meat and eggs.
+
* '''''Gallus gallus''''' is a tropical member of the family Phasianidae, it is the primary progenitor of the domestic chicken. The red junglefowl was first domesticated at least five thousand years ago in Asia. Since then it has spread around the world, and the domestic form is kept globally as a productive food source of both meat and eggs. ''Gallus gallus'' is an important model organism that bridges the evolutionary gap between mammals and other vertebrates and serves as the main laboratory model for the approximately 9,600 extant avian species <ref name="ref1"/> <ref name="ref2"/>.
* The chicken (Gallus gallus) is an important model organism that bridges the evolutionary gap between mammals and other vertebrates and serves as the main laboratory model for the approx9,600 extant avian species. The chicken also represents the first agricultural animal to have its genome sequenced. Modern birds (Ornithurae) evolved from therapod dinosaurs9, 10 in the middle of the Mesozoic era.  <ref name="ref1"/> <ref name="ref2"/>.
 
 
* <font color=blue>'''Common Name:'''</font> '''Red junglefowl'''
 
* <font color=blue>'''Common Name:'''</font> '''Red junglefowl'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9031 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9031 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Lymphoid Organs'''''==
 
=='''''Lymphoid Organs'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 20: Line 19:
 
|-
 
|-
 
|align="center"| TBP<ref name="ref1"/>
 
|align="center"| TBP<ref name="ref1"/>
|align="center"| TA-TA binding protein 1 mRNA, partial cds
+
|align="center"| TATA binding protein  
 
|
 
|
 
* Chicken lymphoid organs  
 
* Chicken lymphoid organs  
Line 26: Line 25:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:AGCTCTGGGATAGTGCCACAG
 
* F:AGCTCTGGGATAGTGCCACAG
* R:AGCTCTGGGATAGTGCCACAG
+
* R:ATAATAACAGCAGCAAAACGCTTG
 
|align="center"|  134  
 
|align="center"|  134  
 
|align="center"| 60
 
|align="center"| 60
Line 32: Line 31:
 
|-
 
|-
 
|align="center"| GAPDH<ref name="ref1"/>
 
|align="center"| GAPDH<ref name="ref1"/>
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase mRNA,complete cds.
+
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 
|
 
|
 
* Chicken lymphoid organs  
 
* Chicken lymphoid organs  
Line 38: Line 37:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GAAGGCTGGGGCTCATCTG
 
* F:GAAGGCTGGGGCTCATCTG
* R:GAAGGCTGGGGCTCATCTG
+
* R:CAGTTGGTGGTGCACGATG
 
|align="center"|  150  
 
|align="center"|  150  
 
|align="center"| 60
 
|align="center"| 60
Line 44: Line 43:
 
|-
 
|-
 
|align="center"| r28S<ref name="ref1"/>
 
|align="center"| r28S<ref name="ref1"/>
|align="center"| 28S rRNA gene, clone GgLSU-1.
+
|align="center"| 28S rRNA gene
 
|
 
|
 
* Chicken lymphoid organs  
 
* Chicken lymphoid organs  
Line 50: Line 49:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GGCGAAGCCAGAGGAAACT
 
* F:GGCGAAGCCAGAGGAAACT
* R:GGCGAAGCCAGAGGAAACT
+
* R:GACGACCGATTTGCACGTC
 
|align="center"|  62  
 
|align="center"|  62  
 
|align="center"| 60
 
|align="center"| 60
Line 68: Line 67:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''5''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=2315072174273555406&as_sdt=2005&sciodt=0,5&hl=en '''6'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Embryo Fibroblasts'''''==
 
=='''''Embryo Fibroblasts'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 89: Line 88:
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/L08165.1 '''L08165''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/L08165.1 '''L08165''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
* F:cagacatcagggtgtgatgg
+
* F:CAGACATCAGGGTGTGATGG
* R: tcaggggctactctcagctc
+
* R: TCAGGGGCTACTCTCAGCTC
 
|align="center"| 183
 
|align="center"| 183
 
|align="center"| NA
 
|align="center"| NA
Line 101: Line 100:
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_204848.1 '''NM_204848''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_204848.1 '''NM_204848''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
* F: tggtggggatgacctctcaa
+
* F: TGGTGGGGATGACCTCTCAA
* R: ggccgatatcccacacttcg
+
* R: GGCCGATATCCCACACTTCG
 
|align="center"| 177
 
|align="center"| 177
 
|align="center"| NA
 
|align="center"| NA
Line 113: Line 112:
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_417846 '''XM_417846''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_417846 '''XM_417846''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
* F: ggctgggagaatcgcatagg
+
* F: GGCTGGGAGAATCGCATAGG
* R: ggccgatatcccacacttcg
+
* R: GGCCGATATCCCACACTTCG
 
|align="center"| 131
 
|align="center"| 131
 
|align="center"| NA
 
|align="center"| NA
Line 129: Line 128:
 
*'''Institution''': Department of Veterinary Preventive Medicine, College of Animal Science and Veterinary Medicine, Jilin University, Xi’an Road 5333, Changchun, Jilin 130062, China
 
*'''Institution''': Department of Veterinary Preventive Medicine, College of Animal Science and Veterinary Medicine, Jilin University, Xi’an Road 5333, Changchun, Jilin 130062, China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''14''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=13405743498904358751&as_sdt=2005&sciodt=0,5&hl=en '''25'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 140: Line 139:
 
</ref>
 
</ref>
 
</references>
 
</references>
 
+
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
[[Category:mRNA]] 
+
[[Category:mRNA]]
 
[[Category:SYBR]]
 
[[Category:SYBR]]
[[Category:28S rRNA]] [[Category:ACT]] [[Category:GAPDH]] [[Category:HMBS]] [[Category:HPRT]] [[Category:TBP]]
+
[[Category:Other rRNA]] [[Category:ACT]] [[Category:GAPDH]] [[Category:HMBS]] [[Category:HPRT]] [[Category:TBP]]
 
[[Category:Specific Tissue]]  [[Category:Different Developmental Stages]]
 
[[Category:Specific Tissue]]  [[Category:Different Developmental Stages]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:Delta Ct]]

Latest revision as of 08:02, 1 September 2017

Description

Gallus gallus.png
  • Gallus gallus is a tropical member of the family Phasianidae, it is the primary progenitor of the domestic chicken. The red junglefowl was first domesticated at least five thousand years ago in Asia. Since then it has spread around the world, and the domestic form is kept globally as a productive food source of both meat and eggs. Gallus gallus is an important model organism that bridges the evolutionary gap between mammals and other vertebrates and serves as the main laboratory model for the approximately 9,600 extant avian species [1] [2].
  • Common Name: Red junglefowl
  • NCBI Taxonomy

Lymphoid Organs

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
TBP[1] TATA binding protein
  • Chicken lymphoid organs
AF221563
  • F:AGCTCTGGGATAGTGCCACAG
  • R:ATAATAACAGCAGCAAAACGCTTG
134 60 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Chicken lymphoid organs
AF047874
  • F:GAAGGCTGGGGCTCATCTG
  • R:CAGTTGGTGGTGCACGATG
150 60 SYBR
r28S[1] 28S rRNA gene
  • Chicken lymphoid organs
FM165415
  • F:GGCGAAGCCAGAGGAAACT
  • R:GACGACCGATTTGCACGTC
62 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: D. Borowska
  • Email: dominika.borowska@roslin.ed.ac.uk
  • Institution: The Roslin Institute and R(D)SVS, University of Edinburgh, Easter Bush, Midlothian EH25 9RG, United Kingdom

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

Embryo Fibroblasts

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACTB[2] Beta-actin
  • In chicken embryo fibroblast following NDV treatment over a time up to 72 h
L08165
  • F:CAGACATCAGGGTGTGATGG
  • R: TCAGGGGCTACTCTCAGCTC
183 NA SYBR
HPRT1[2] Hypoxanthine phosphorribosyltransferase 1
  • In chicken embryo fibroblast following NDV treatment over a time up to 73 h
NM_204848
  • F: TGGTGGGGATGACCTCTCAA
  • R: GGCCGATATCCCACACTTCG
177 NA SYBR
HMBS[2] Hydroxymethylbilane synthase
  • In chicken embryo fibroblast following NDV treatment over a time up to 74 h
XM_417846
  • F: GGCTGGGAGAATCGCATAGG
  • R: GGCCGATATCCCACACTTCG
131 NA SYBR

Molecular types

  • mRNA

Evaluation Methods

Contact

  • Name: Zhuang Ding
  • Email: renfu.yin@helmholtz-muenchen.de
  • Institution: Department of Veterinary Preventive Medicine, College of Animal Science and Veterinary Medicine, Jilin University, Xi’an Road 5333, Changchun, Jilin 130062, China

Citation Statistics

Cited by 25 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Borowska D, Rothwell L, Bailey RA, Watson K, Kaiser P (2016) Identification of stable reference genes for quantitative PCR in cells derived from chicken lymphoid organs. Vet Immunol Immunopathol 170, 20-24.
  2. 2.0 2.1 2.2 2.3 Yin R, Liu X, Liu C, et al. Systematic selection of housekeeping genes for gene expression normalization in chicken embryo fibroblasts infected with Newcastle disease virus[J]. Biochemical and biophysical research communications, 2011, 413(4): 537-540.

Categories