Gallus gallus

From ICG
Revision as of 13:29, 22 June 2017 by ICG Expert4 (talk | contribs)
Jump to navigation Jump to search


  • "Gallus gallus" redirects here. For other subspecies, see Chicken. The red junglefowl (Gallus gallus) is a tropical member of the family Phasianidae. It is the primary progenitor of the domestic chicken (though genetic evidence strongly suggests some past hybridisation with the grey junglefowl as well). The red junglefowl was first domesticated at least five thousand years ago in Asia. Since then it has spread around the world, and the domestic form is kept globally as a very productive food source of both meat and eggs.
  • The chicken (Gallus gallus) is an important model organism that bridges the evolutionary gap between mammals and other vertebrates and serves as the main laboratory model for the approx9,600 extant avian species. The chicken also represents the first agricultural animal to have its genome sequenced. Modern birds (Ornithurae) evolved from therapod dinosaurs9, 10 in the middle of the Mesozoic era. [1] [2].
  • Common Name: Red junglefowl
  • NCBI Taxonomy

Lymphoid Organs

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
TBP[1] TA-TA binding protein 1 mRNA, partial cds
  • Chicken lymphoid organs
134 60 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase mRNA,complete cds.
  • Chicken lymphoid organs
150 60 SYBR
r28S[1] 28S rRNA gene, clone GgLSU-1.
  • Chicken lymphoid organs
62 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods


  • Name: D. Borowska
  • Email:
  • Institution: The Roslin Institute and R(D)SVS, University of Edinburgh, Easter Bush, Midlothian EH25 9RG, United Kingdom

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-06-01])

Embryo Fibroblasts

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
Size [bp] Tm [℃] Detection
ACTB[2] Beta-actin
  • In chicken embryo fibroblast following NDV treatment over a time up to 72 h
  • F:cagacatcagggtgtgatgg
  • R: tcaggggctactctcagctc
HPRT1[2] Hypoxanthine phosphorribosyltransferase 1
  • In chicken embryo fibroblast following NDV treatment over a time up to 73 h
  • F: tggtggggatgacctctcaa
  • R: ggccgatatcccacacttcg
HMBS[2] Hydroxymethylbilane synthase
  • In chicken embryo fibroblast following NDV treatment over a time up to 74 h
  • F: ggctgggagaatcgcatagg
  • R: ggccgatatcccacacttcg

Molecular types

  • mRNA

Evaluation Methods


  • Name: Zhuang Ding
  • Email:
  • Institution: Department of Veterinary Preventive Medicine, College of Animal Science and Veterinary Medicine, Jilin University, Xi’an Road 5333, Changchun, Jilin 130062, China

Citation Statistics

Cited by 14 (Based on Google Scholar [2017-06-01])


  1. 1.0 1.1 1.2 1.3 Borowska D, Rothwell L, Bailey RA, Watson K, Kaiser P (2016) Identification of stable reference genes for quantitative PCR in cells derived from chicken lymphoid organs. Vet Immunol Immunopathol 170, 20-24.
  2. 2.0 2.1 2.2 2.3 Yin R, Liu X, Liu C, et al. Systematic selection of housekeeping genes for gene expression normalization in chicken embryo fibroblasts infected with Newcastle disease virus[J]. Biochemical and biophysical research communications, 2011, 413(4): 537-540.