Difference between revisions of "Ganoderma lucidum"

From ICG
Jump to navigation Jump to search
 
(2 intermediate revisions by 2 users not shown)
Line 22: Line 22:
 
|
 
|
 
* Different fermentation conditions
 
* Different fermentation conditions
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_002028659.1 '''XM_002028659 ''']
+
|align="center"| '''GL15755'''
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CACGCTTATCATATCCACTCCA
 
* F:CACGCTTATCATATCCACTCCA
Line 34: Line 34:
 
|
 
|
 
*Primordia, the stipes of fruiting bodies, the pilei of fruiting bodies
 
*Primordia, the stipes of fruiting bodies, the pilei of fruiting bodies
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_002018749.1 '''XM_002018749 ''']
+
|align="center"| '''GL25990'''
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GTCAACAAGGGCGTTCTCTT
 
* F:GTCAACAAGGGCGTTCTCTT
Line 47: Line 47:
 
* Different fermentation conditions
 
* Different fermentation conditions
 
*Primordia, the stipes of fruiting bodies, the pilei of fruiting bodies
 
*Primordia, the stipes of fruiting bodies, the pilei of fruiting bodies
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NW_001986729.1 '''NW_001986729''']
+
|align="center"| '''GL27826'''
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CAGTTCACGGCGATGTTCA
 
* F:CAGTTCACGGCGATGTTCA
Line 70: Line 70:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''10''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=7604645007061797601&as_sdt=2005&sciodt=0,5&hl=en '''10'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 81: Line 81:
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
Qian J, Xu H, Song J, Xu J, Zhu Y, Chen S (2013) Genome-wide
+
Qian J, Xu H, Song J, Xu J, Zhu Y, Chen S. Genome-wide analysis of simple
analysis of simple sequence repeats in the model medicinal
+
sequence repeats in the model medicinal mushroom Ganoderma lucidum. Gene. 2013
mushroom Ganoderma lucidum. Gene 512:331–336
+
Jan 10;512(2):331-6. doi: 10.1016/j.gene.2012.09.127. Epub 2012 Oct 13. PubMed
 +
PMID: 23069850.
 +
 
 
</ref>
 
</ref>
 
</references>
 
</references>

Latest revision as of 05:14, 1 September 2017

Description

Ganoderma lucidum-1.jpg
  • Ganoderma lucidum, a white rot basidiomycete belonging to the order Polyporales, is one of the most well-known medicinal mushrooms in the world. G. lucidum has been used as a remedy for thousands years in East Asia. This species is documented as LingZhi in Chinese Pharmacopoeia and is included in the American Herbal Pharmacopoeia and Therapeutic Compendium [1][2].
  • Common Name: Ling zhi
  • NCBI Taxonomy

Different Tissues & Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
PP2A[1] protein phosphatase 2A
  • Different fermentation conditions
GL15755
  • F:CACGCTTATCATATCCACTCCA
  • R:GGCTTGATGTCCACGATGTT
131 60 SYBR
RPL4[1] ribosomal protein L4
  • Primordia, the stipes of fruiting bodies, the pilei of fruiting bodies
GL25990
  • F:GTCAACAAGGGCGTTCTCTT
  • R:ACAGCGTCTTGAGGAAGGT
151 60 SYBR
BTU[1] β-tubulin
  • Different fermentation conditions
  • Primordia, the stipes of fruiting bodies, the pilei of fruiting bodies
GL27826
  • F:CAGTTCACGGCGATGTTCA
  • R:CGACGGTAGCATCCTGGTA
142 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jiang Xu
  • Email: xj8442cn@gmail.com
  • Institution: The National Engineering Laboratory for Breeding of Endangered Medicinal Materials, Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences and Peking Union Medical College, No. 151, Malianwa North Road, HaiDian District, Beijing 100193, China

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Xu J, Xu Z, Zhu Y, Luo H, Qian J, Ji A, Hu Y, Sun W, Wang B, Song J, Sun C, Chen S. Identification and evaluation of reference genes for qRT-PCR normalization in Ganoderma lucidum. Curr Microbiol. 2014 Jan;68(1):120-6. doi: 10.1007/s00284-013-0442-2. Epub 2013 Sep 8. PubMed PMID: 24013612.
  2. Qian J, Xu H, Song J, Xu J, Zhu Y, Chen S. Genome-wide analysis of simple sequence repeats in the model medicinal mushroom Ganoderma lucidum. Gene. 2013 Jan 10;512(2):331-6. doi: 10.1016/j.gene.2012.09.127. Epub 2012 Oct 13. PubMed PMID: 23069850.

Categories