Difference between revisions of "Ganoderma lucidum"

From ICG
Jump to navigation Jump to search
Line 2: Line 2:
 
[[File:Ganoderma lucidum-1.jpg|right|200px]]
 
[[File:Ganoderma lucidum-1.jpg|right|200px]]
 
* '''''Ganoderma lucidum''''', a white rot basidiomycete belonging to the order Polyporales, is one of the most well-known medicinal mushrooms in the world. G. lucidum has been used as a remedy for thousands years in East Asia. This species is documented as LingZhi in Chinese Pharmacopoeia and is included in the American Herbal Pharmacopoeia and Therapeutic Compendium. <ref name="ref1"/><ref name="ref2"/>.
 
* '''''Ganoderma lucidum''''', a white rot basidiomycete belonging to the order Polyporales, is one of the most well-known medicinal mushrooms in the world. G. lucidum has been used as a remedy for thousands years in East Asia. This species is documented as LingZhi in Chinese Pharmacopoeia and is included in the American Herbal Pharmacopoeia and Therapeutic Compendium. <ref name="ref1"/><ref name="ref2"/>.
* <font color=blue>'''Common Name:'''</font> '''Lingzhi'''
+
* <font color=blue>'''Common Name:'''</font> '''Ling zhi'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=5315&lvl=3&lin=f&keep=1&srchmode=1&unlock <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=5315&lvl=3&lin=f&keep=1&srchmode=1&unlock <font color=blue>'''NCBI Taxonomy'''</font>]
 +
 
=='''''Different Tissues & Developmental Stages'''''==
 
=='''''Different Tissues & Developmental Stages'''''==
 
===Internal Control Genes===
 
===Internal Control Genes===

Revision as of 08:52, 9 August 2017

Description

Ganoderma lucidum-1.jpg
  • Ganoderma lucidum, a white rot basidiomycete belonging to the order Polyporales, is one of the most well-known medicinal mushrooms in the world. G. lucidum has been used as a remedy for thousands years in East Asia. This species is documented as LingZhi in Chinese Pharmacopoeia and is included in the American Herbal Pharmacopoeia and Therapeutic Compendium. [1][2].
  • Common Name: Ling zhi
  • NCBI Taxonomy

Different Tissues & Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
PP2A[1] protein phosphatase 2A
  • Different fermentation conditions
XM_002028659
  • F:CACGCTTATCATATCCACTCCA
  • R:GGCTTGATGTCCACGATGTT
131 60 SYBR
RPL4[1] ribosomal protein L4
  • Different tissues
XM_002018749
  • F:GTCAACAAGGGCGTTCTCTT
  • R:ACAGCGTCTTGAGGAAGGT
151 60 SYBR
BTU[1] β-tubulin
  • Primordia, the stipes of fruiting bodies, the pilei of fruiting bodies
NW_001986729
  • F:CAGTTCACGGCGATGTTCA
  • R:CGACGGTAGCATCCTGGTA
142 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Jiang Xu
  • Email: xj8442cn@gmail.com
  • Institute: The National Engineering Laboratory for Breeding of Endangered Medicinal Materials, Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences and Peking Union Medical College, No. 151, Malianwa North Road, HaiDian District, Beijing 100193, China

Citation Statistics

Cited by ?? (Based on Google Scholar [2017-08-01])

References

  1. 1.0 1.1 1.2 1.3 Xu J, Xu Z, Zhu Y, Luo H, Qian J, Ji A, Hu Y, Sun W, Wang B, Song J, Sun C, Chen S. Identification and evaluation of reference genes for qRT-PCR normalization in Ganoderma lucidum. Curr Microbiol. 2014 Jan;68(1):120-6. doi: 10.1007/s00284-013-0442-2. Epub 2013 Sep 8. PubMed PMID: 24013612.
  2. Qian J, Xu H, Song J, Xu J, Zhu Y, Chen S (2013) Genome-wide analysis of simple sequence repeats in the model medicinal mushroom Ganoderma lucidum. Gene 512:331–336

Categories