Difference between revisions of "Ganoderma lucidum"

Revision as of 08:38, 17 August 2017

Ganoderma lucidum, a white rot basidiomycete belonging to the order Polyporales, is one of the most well-known medicinal mushrooms in the world. G. lucidum has been used as a remedy for thousands years in East Asia. This species is documented as LingZhi in Chinese Pharmacopoeia and is included in the American Herbal Pharmacopoeia and Therapeutic Compendium ^[1]^[2].
Common Name: Ling zhi
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
PP2A^[1]	protein phosphatase 2A	Different fermentation conditions	XM_002028659	F:CACGCTTATCATATCCACTCCA R:GGCTTGATGTCCACGATGTT	131	60	SYBR
RPL4^[1]	ribosomal protein L4	Different tissues	XM_002018749	F:GTCAACAAGGGCGTTCTCTT R:ACAGCGTCTTGAGGAAGGT	151	60	SYBR
BTU^[1]	β-tubulin	Primordia, the stipes of fruiting bodies, the pilei of fruiting bodies	NW_001986729	F:CAGTTCACGGCGATGTTCA R:CGACGGTAGCATCCTGGTA	142	60	SYBR

Name: Jiang Xu
Email: xj8442cn@gmail.com
Institution: The National Engineering Laboratory for Breeding of Endangered Medicinal Materials, Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences and Peking Union Medical College, No. 151, Malianwa North Road, HaiDian District, Beijing 100193, China

Cited by 10 (Based on Google Scholar [2017-08-10])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Xu J, Xu Z, Zhu Y, Luo H, Qian J, Ji A, Hu Y, Sun W, Wang B, Song J, Sun C, Chen S. Identification and evaluation of reference genes for qRT-PCR normalization in Ganoderma lucidum. Curr Microbiol. 2014 Jan;68(1):120-6. doi: 10.1007/s00284-013-0442-2. Epub 2013 Sep 8. PubMed PMID: 24013612.
↑ Qian J, Xu H, Song J, Xu J, Zhu Y, Chen S (2013) Genome-wide analysis of simple sequence repeats in the model medicinal mushroom Ganoderma lucidum. Gene 512:331–336

@@ Line 66: / Line 66: @@
 *'''Name''': Jiang Xu
 *'''Email''': xj8442cn@gmail.com
-*'''Institute''': The National Engineering Laboratory for Breeding of Endangered Medicinal Materials, Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences and Peking Union Medical College, No. 151, Malianwa North Road, HaiDian District, Beijing 100193, China
+*'''Institution''': The National Engineering Laboratory for Breeding of Endangered Medicinal Materials, Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences and Peking Union Medical College, No. 151, Malianwa North Road, HaiDian District, Beijing 100193, China
 ===Citation Statistics===
 Cited by '''10''' (Based on Google Scholar [2017-08-10])