Difference between revisions of "Gene:18S rRNA"

From ICG
Jump to navigation Jump to search
(Created page with "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Species ! Gene Synonymous !...")
 
 
(5 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 
=='''''Synonymous Genes'''''==
 
=='''''Synonymous Genes'''''==
 +
* 18S rRNA <=> 18S,18S rRNA
  
=='''''Experimental Validated ICGs'''''==
+
=='''''Applicable Species'''''==
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 226: Line 227:
 
|align="center"|2013
 
|align="center"|2013
 
|}
 
|}
 +
 +
=='''Featured Sequence'''==
 +
{{DNA|
 +
DNA = <dnaseqindica>CTGCTTGATCCTGCCAGTAGTTATATGCTTGTCTCAAAGGTTAAGCCATGCATGTCTAAGTACACACGAA
 +
TTAAAAGTGAAACCGCAAAAGGCTCATTATATCAGTTATGGTTCCTTAGATCGTTAACAGTTACTTGGAT
 +
AACTGTGGTAATTCTAGAGCTAATACATGCAATATAAATACGGACCTTTGGGACGTATGCTTTTATTAGG
 +
CTAAAACCAAGCGATCGCAAGATCGTTATTATGGTTGAACTCTAGATAACTTGCTGATCGTATGGTCTTG
 +
TACCGACGACAGATCTTTCAAATGTCTGCCCTATCAACTTTTGATGGTAGTATCTAGGACTACCATGGTT
 +
GCGACGGGTAACGGGGAATCAGGGTTCGATTCCGGTGAGGGAGCCTGAGAAACGGCTACCACATCTAAGG
 +
AAGGCAGCAGGCGCGTAAATTACCCACTCCCAGCTCGGGGAGGTAGTGACGAAAAATAACAATACAGGAC
 +
TCATATTAGAGGCCCTGTAATTGGAATGAGTACACTTTAAATCCTTTAACAAGGACCTATTGGAGGGCAA
 +
GTCTGGTGCCAGCAGCCGCGGTAACTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCGGTTAAAACGTT
 +
CGTAGTTGAACTTGTGCTTCATACGGGTAGTACAACTATAATTGTAGTTTGTACTGTACCTTATGCATGT
 +
AAGCGTATTACCGGTGGAGTTCTTATATGTATTAAATACTTGTATTTGTGCATATTCCTCCTATTTAAAC
 +
CTGCTTCAGTGCTCTTCATCGAGTGTTGTTGTGGGCCGGTACAATTACTTTGAACAAATTAGAGTGTTTA
 +
AAGCAGGCTCCAAATGCCTGAATATTTTGTGCATGGAATAATGAAATAAGACCTCTGTTCTACTTTCATT
 +
GGTTTTTAGATCAAGAGGTAATGATTAATAGAAGCAGTTTGGGGGCATTAGTATTACNACGCGAGAGGTG
 +
AAATTCTTGGACCGTCGTAAGGACTAACTTAAGCGAAAGCATTTGCCAAAGATGTTTTCATTAATCAAGA
 +
ACGAAAGTTAGAGGTTCGAAGGCGATCAGATACCGCCCTAGTTCTAACCATAAACGATGCCAGCTAGCAA
 +
TTGGGTGTAGCTACTATCATGGCTCTCTCAGTCGCTTCCCGGGAAACCAAAGCTTTTGGGCTCCGGGGGA
 +
AGTATGGTTGCAAAGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTT
 +
AATTTGACTCAACACGGGAAAACTTACCAGGTCCGAACATAAGTGTGTAAGACAGATTGATAGCTCTTTC
 +
TCGAATCTATGGGTGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATTTGTCTGGTTAATTCCGATAA
 +
CGAACGAGACTCAAATATATTAAATAGATGCTTTCAGGATTATGGTGTTTGAAGCTTTTGTAGCCTTCAT
 +
TCATGAGTGCAGTAAAATGTGTGAGTGTTTGAATGTGTTTATGAAAGTGGAGCCGTACCTGTTGGTTTGT
 +
CCCATTATAAGGACACTAGCTTCTTAAATGGACAAATTGCGTCTAGCAATAATGAGATTGAGCAATAACA
 +
GGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACAATGAAAGTATCAACGTGTATTTCCTA
 +
GACCGAGAGGTCCGGGTAAACCGCTGAACCACTTTCATGCTTGGGATTGTGAACTGAAACTGTTCACATG
 +
AACTTGGAATTCCCAGTAAGTGTGAGTCATTAACTCGCATTGATTACGTCCCTGCCCTTATACTCACCGC
 +
CCGTCGCTACTACCGATTG</dnaseqindica>|
 +
SOURCE = '''''Lucilia cuprina''''' 18S rRNA|
 +
}}
  
 
=='''''External Links'''''==
 
=='''''External Links'''''==
* [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?uid=pfam01342 NCBI COnserved Protein Domain Family]
+
* [https://en.wikipedia.org/wiki/18S_ribosomal_RNA WikiPedia]
* [https://en.wikipedia.org/wiki/SAND_DNA-binding_protein_domain WikiPedia]
 
* [http://pfam.xfam.org/family/SAND Pfam]
 

Latest revision as of 02:18, 30 August 2017

Synonymous Genes

  • 18S rRNA <=> 18S,18S rRNA

Applicable Species

Species Gene Synonymous Application scenarios Publication Year
Actinidia chinensis 18S ribosomal RNA
  • Different Developmental Stages & Tissues
2016
Ammopiptanthus mongolicus Ribosomal RNA 18S
  • Abiotic Stresses
2012
Aphis gossypii 18S ribosomal
  • Different Developmental Stages & Geographical Populations
2016
Callithrix jacchus 18S ribosomal RNA
  • Different Tissues
2013
Citrus clementina 18S ribosomal RNA
  • Different Genotypes
2012
Citrus maxima 18S ribosomal RNA
  • Different Genotypes
2012
Citrus sinensis 18S ribosomal RNA
  • Different Genotypes
2012
Ctenopharyngodon idella 18S ribosomal RNA
  • Tissues & Cell Culture
2011
Drosophila melanogaster Small ribosomal submit
  • Physiological Responses
2011
Eucalyptus grandis RNA ribosomal 18S
  • In Vitro Adventitious Rooting
2010
Hibiscus cannabinus 18S rRNA
  • Salinity & Drought Stress
2015
Lucilia cuprina 18S rRNA
  • Different Developmental Stages
2010
Mus musculus 18S rRNA
  • Preimplantation Embryos
2014
Mus musculus 18S Ribosomal RNA
  • Obesity Model
2014
Oreochromis niloticus 18S ribosomal RNA
  • Different Tissues & Bacterial Infection
2013
Oryctolagus cuniculus 18S Ribosomal RNA
  • Cartilage Tissue Injury & Repair
2012
Pandora neoaphidis 18S ribosomal RNA
  • Different Developmental Stages & Nutritional Conditions
2016
Pecten maximus 18S ribosomal RNA
  • Different Tissues
2012
Posidonia oceanica Ribosomal RNA 18S
  • Abiotic Stress
2012
Rhodnius prolixus 18S ribosomal RNA
  • Different Experimental Conditions
2012
Sesamia inferens 18S ribosomal RNA
  • Different Tissues & Developmental Stages
2015
Sus scrofa 18S ribosomal RNA
  • Oocytes & Preimplantation Embryos
2007
Triticum aestivum 18S rRNA
  • Rust Infection
2013
Tuber melanosporum 18S ribosomal RNA
  • Different Developmental Stages
2015
Ulva linza 18S rRNA
  • Different Experimental Conditions
2012
Vigna mungo 18S rRNA
  • Biotic and Abiotic stress
2013
Volvox carteri 18S ribosomal RNA
  • Developmental Stages & Stress Treatments
2013

Featured Sequence

The Sequence of Lucilia cuprina 18S rRNA is displayed as example.

000001 CTGCTTGATC CTGCCAGTAG TTATATGCTT GTCTCAAAGG TTAAGCCATG CATGTCTAAG TACACACGAA 000070
000071 TTAAAAGTGA AACCGCAAAA GGCTCATTAT ATCAGTTATG GTTCCTTAGA TCGTTAACAG TTACTTGGAT 000140
000141 AACTGTGGTA ATTCTAGAGC TAATACATGC AATATAAATA CGGACCTTTG GGACGTATGC TTTTATTAGG 000210
000211 CTAAAACCAA GCGATCGCAA GATCGTTATT ATGGTTGAAC TCTAGATAAC TTGCTGATCG TATGGTCTTG 000280
000281 TACCGACGAC AGATCTTTCA AATGTCTGCC CTATCAACTT TTGATGGTAG TATCTAGGAC TACCATGGTT 000350
000351 GCGACGGGTA ACGGGGAATC AGGGTTCGAT TCCGGTGAGG GAGCCTGAGA AACGGCTACC ACATCTAAGG 000420
000421 AAGGCAGCAG GCGCGTAAAT TACCCACTCC CAGCTCGGGG AGGTAGTGAC GAAAAATAAC AATACAGGAC 000490
000491 TCATATTAGA GGCCCTGTAA TTGGAATGAG TACACTTTAA ATCCTTTAAC AAGGACCTAT TGGAGGGCAA 000560
000561 GTCTGGTGCC AGCAGCCGCG GTAACTCCAG CTCCAATAGC GTATATTAAA GTTGTTGCGG TTAAAACGTT 000630
000631 CGTAGTTGAA CTTGTGCTTC ATACGGGTAG TACAACTATA ATTGTAGTTT GTACTGTACC TTATGCATGT 000700
000701 AAGCGTATTA CCGGTGGAGT TCTTATATGT ATTAAATACT TGTATTTGTG CATATTCCTC CTATTTAAAC 000770
000771 CTGCTTCAGT GCTCTTCATC GAGTGTTGTT GTGGGCCGGT ACAATTACTT TGAACAAATT AGAGTGTTTA 000840
000841 AAGCAGGCTC CAAATGCCTG AATATTTTGT GCATGGAATA ATGAAATAAG ACCTCTGTTC TACTTTCATT 000910
000911 GGTTTTTAGA TCAAGAGGTA ATGATTAATA GAAGCAGTTT GGGGGCATTA GTATTACNAC GCGAGAGGTG 000980
000981 AAATTCTTGG ACCGTCGTAA GGACTAACTT AAGCGAAAGC ATTTGCCAAA GATGTTTTCA TTAATCAAGA 001050
001051 ACGAAAGTTA GAGGTTCGAA GGCGATCAGA TACCGCCCTA GTTCTAACCA TAAACGATGC CAGCTAGCAA 001120
001121 TTGGGTGTAG CTACTATCAT GGCTCTCTCA GTCGCTTCCC GGGAAACCAA AGCTTTTGGG CTCCGGGGGA 001190
001191 AGTATGGTTG CAAAGCTGAA ACTTAAAGGA ATTGACGGAA GGGCACCACC AGGAGTGGAG CCTGCGGCTT 001260
001261 AATTTGACTC AACACGGGAA AACTTACCAG GTCCGAACAT AAGTGTGTAA GACAGATTGA TAGCTCTTTC 001330
001331 TCGAATCTAT GGGTGGTGGT GCATGGCCGT TCTTAGTTCG TGGAGTGATT TGTCTGGTTA ATTCCGATAA 001400
001401 CGAACGAGAC TCAAATATAT TAAATAGATG CTTTCAGGAT TATGGTGTTT GAAGCTTTTG TAGCCTTCAT 001470
001471 TCATGAGTGC AGTAAAATGT GTGAGTGTTT GAATGTGTTT ATGAAAGTGG AGCCGTACCT GTTGGTTTGT 001540
001541 CCCATTATAA GGACACTAGC TTCTTAAATG GACAAATTGC GTCTAGCAAT AATGAGATTG AGCAATAACA 001610
001611 GGTCTGTGAT GCCCTTAGAT GTCCTGGGCT GCACGCGCGC TACAATGAAA GTATCAACGT GTATTTCCTA 001680
001681 GACCGAGAGG TCCGGGTAAA CCGCTGAACC ACTTTCATGC TTGGGATTGT GAACTGAAAC TGTTCACATG 001750
001751 AACTTGGAAT TCCCAGTAAG TGTGAGTCAT TAACTCGCAT TGATTACGTC CCTGCCCTTA TACTCACCGC 001820
001821 CCGTCGCTAC TACCGATTG

External Links