Difference between revisions of "Gene:ABCT"

From ICG
Jump to navigation Jump to search
 
(6 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 
=='''''Synonymous Genes'''''==
 
=='''''Synonymous Genes'''''==
 +
* ABCT <=> ABCT
  
=='''''Experimental Validated ICGs'''''==
+
=='''''Applicable Species'''''==
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 43: Line 44:
 
|-
 
|-
 
|}
 
|}
 +
 +
=='''Featured Sequence'''==
 +
{{DNA|
 +
DNA = <dnaseqindica>ATTGATTCTGGATTAGATGTCGATGCTCTACGAGATGTGGCCAAAGCAGTAAATGGATTCTTGACACCCA
 +
CGAATTCAGTTCTGATGATAACTCATTATCTTCGTCTTTTGGAATTCATCAAGCCAACTTACGTCCACAT
 +
CATGGAGAATGGAAGAATTATTGAAACAGGGGATTCATCCGTGGCGAAACGTATTGAGAAAGAAGGATAC
 +
AAAGTGCTCTCTTCCACATAAAACTTCTTAAGAATTGGTACGGTGAACAAATGCTAACCCCAGCAACTAT
 +
TGGATCTTATGCTCCTCAACAAGAGCAATGCCAAACTGTCCTTTCAGTTTTGCGGCAACTATAATTTCTT
 +
CCAAGTGATAATCATTGCTAGAGAAACGCATTTTCATTGAATGTGCTGGCAAAACTTCAAATAAACGATA
 +
TTTGATGTCGATNCTGGTACCTACCATTATGCATACAAAACTACGTGAAGCTTACTGTTTTGGACAGTCG
 +
AGGAATTGGAATGTGCATATCCTCGTTACTTTGGTGTCACGGAT</dnaseqindica>|
 +
SOURCE = '''''Cyclamen persicum''''' ABCT|
 +
}}
 +
 +
=='''Conserved Domains '''==
 +
{{Str|
 +
SOURCE = '''''Cyclamen persicum''''' ABCT|
 +
Str= [[File:ABCT.png|center|770px|link=http://icg.big.ac.cn/index.php/Gene:ABCT]]|
 +
}}
  
 
=='''''External Links'''''==
 
=='''''External Links'''''==
* [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?uid=pfam01342 NCBI COnserved Protein Domain Family]
+
* [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?ascbin=8&maxaln=10&seltype=2&uid=cd03217 NCBI Conserved Protein Domain Family]
* [https://en.wikipedia.org/wiki/SAND_DNA-binding_protein_domain WikiPedia]
+
* [https://en.wikipedia.org/wiki/ATP-binding_cassette_transporter WikiPedia]
* [http://pfam.xfam.org/family/SAND Pfam]
 

Latest revision as of 02:40, 30 August 2017

Synonymous Genes

  • ABCT <=> ABCT

Applicable Species

Species Gene Synonymous Application scenarios Publication Year
Cicer arietinum ATP-binding cassette transporter
  • Across Cultivated and Wild Species
2016
Cyclamen persicum ABC transporter ATPase
  • Cell Cultures
2011
Glycine max ATP-binding cassette transporter
  • Biotic Stresses
2015
Glycine max ATP-binding cassette transporter
  • Different Tissues & Abiotic Stress
2012

Featured Sequence

The Sequence of Cyclamen persicum ABCT is displayed as example.

000001 ATTGATTCTG GATTAGATGT CGATGCTCTA CGAGATGTGG CCAAAGCAGT AAATGGATTC TTGACACCCA 000070
000071 CGAATTCAGT TCTGATGATA ACTCATTATC TTCGTCTTTT GGAATTCATC AAGCCAACTT ACGTCCACAT 000140
000141 CATGGAGAAT GGAAGAATTA TTGAAACAGG GGATTCATCC GTGGCGAAAC GTATTGAGAA AGAAGGATAC 000210
000211 AAAGTGCTCT CTTCCACATA AAACTTCTTA AGAATTGGTA CGGTGAACAA ATGCTAACCC CAGCAACTAT 000280
000281 TGGATCTTAT GCTCCTCAAC AAGAGCAATG CCAAACTGTC CTTTCAGTTT TGCGGCAACT ATAATTTCTT 000350
000351 CCAAGTGATA ATCATTGCTA GAGAAACGCA TTTTCATTGA ATGTGCTGGC AAAACTTCAA ATAAACGATA 000420
000421 TTTGATGTCG ATNCTGGTAC CTACCATTAT GCATACAAAA CTACGTGAAG CTTACTGTTT TGGACAGTCG 000490
000491 AGGAATTGGA ATGTGCATAT CCTCGTTACT TTGGTGTCAC GGAT

Conserved Domains

The Conserved domains of Cyclamen persicum ABCT is displayed as example.

ABCT.png

External Links