Difference between revisions of "Gene:ACT"

From ICG
Jump to navigation Jump to search
 
(33 intermediate revisions by 2 users not shown)
Line 1: Line 1:
==Synonymous Genes ==
+
=='''Synonymous Genes'''==
* ACT
+
* ACT <=> Actin, Actin7, beta-actin, Actin 11, Actin1, Actin2, Actin3, Actin5, β-actin, Actin42A, Actin-11, Actin 101, Actin-11, β-actin1, β-actin2
  
==Experimental Validated ICGs==
+
=='''''Applicable Species'''''==
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 16: Line 16:
 
* ''Different Developmental Stages & Tissues''
 
* ''Different Developmental Stages & Tissues''
 
||
 
||
**[https://www.ncbi.nlm.nih.gov/pubmed/26897117 Identification and validation of reference genes for accurate normalization of real-time quantitative PCR data in kiwifruit]
+
*[https://www.ncbi.nlm.nih.gov/pubmed/26897117 Identification and validation of reference genes for accurate normalization of real-time quantitative PCR data in kiwifruit]
 +
|align="center"|2016
 +
|-
 +
|align="center"|[[Agrostis stolonifera]]
 +
|align="center"|Actin7
 +
||
 +
* ''Abiotic Stresses''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/26179072 Selection of reference genes for quantitative real-time PCR normalization in creeping bentgrass involved in four abiotic stresses]
 +
|align="center"|2015
 +
|-
 +
|align="center"|[[Aphis gossypii]]
 +
|align="center"|beta-actin
 +
||
 +
* ''Different Developmental Stages & Geographical Populations''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/28076279 Identification and Validation of Reference Genes for the Normalization of Gene Expression Data in qRT-PCR Analysis in Aphis gossypii (Hemiptera: Aphididae).]
 +
|align="center"|2016
 +
|-
 +
|align="center"|[[Apis mellifera]]
 +
|align="center"|Actin
 +
||
 +
* ''Bacterial Challenge''
 +
||
 +
*[http://www.bioone.org/doi/abs/10.1673/031.008.3301 Reference Gene Selection for Insect Expression Studies Using Quantitative Real-Time PCR: The Head of the Honeybee, Apis mellifera, After a Bacterial Challenge]
 +
|align="center"|2008
 +
|-
 +
|align="center"|[[Arachis hypogaea]]
 +
|align="center"|Actin 11
 +
||
 +
* ''Different Developmental Stages & Abiotic Stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/22203160 Validation of reference genes for gene expression studies in peanut by quantitative real-time RT-PCR]
 +
|align="center"|2012
 +
|-
 +
|align="center"|[[Artemisia annua]]
 +
|align="center"|Actin
 +
||
 +
* ''Different Tissues & Abiotic Stress''
 +
||
 +
*[https://link.springer.com/article/10.1007/s11240-014-0690-2 Reference gene selection in Artemisia annua L., a plant species producing anti-malarial artemisinin]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Aspergillus niger]]
 +
|align="center"|Actin
 +
||
 +
* ''Continuous Cultivation''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/17868942 Selection of reference genes for normalisation of specific gene quantification data of Aspergillus niger]
 +
|align="center"|2007
 +
|-
 +
|align="center"|[[Bactrocera dorsalis]]
 +
|align="center"|Actin1, Actin2, Actin3, Actin5
 +
||
 +
* ''Different Sex & Tissues''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/20923571 Evaluation of endogenous references for gene expression profiling in different tissues of the oriental fruit fly Bactrocera dorsalis (Diptera: Tephritidae)]
 +
|align="center"|2010
 +
|-
 +
|align="center"|[[Bos indicus]]
 +
|align="center"|β-actin
 +
||
 +
* ''Milk Somatic Cells''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/22612931 Selection of suitable reference genes for quantitative gene expression studies in milk somatic cells of lactating cows (Bos indicus)]
 +
|align="center"|2012
 +
|-
 +
|align="center"|[[Brassica napus]]
 +
|align="center"|Actin7
 +
||
 +
* ''Abiotic & Biotic Stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/24770781 Selection of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in Brassica napus under various stress conditions]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Brassica rapa subsp. pekinensis]]
 +
|align="center"|Actin2
 +
||
 +
* ''Different Developmental Stages & Biotic Stress''
 +
||
 +
*[http://www.publish.csiro.au/FP/FP11246 Validation of reference genes for real-time quantitative PCR normalisation in non-heading Chinese cabbage]
 +
|align="center"|2012
 +
|-
 +
|align="center"|[[Callithrix jacchus]]
 +
|align="center"|b-Actin
 +
||
 +
* ''Different Tissues''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/?term=24068436 Selection of suitable reference genes for mRNA quantification studies using common marmoset tissues]
 +
|align="center"|2013
 +
|-
 +
|align="center"|[[Channa striatus]]
 +
|align="center"|beta-actin
 +
||
 +
* ''High-temperature Stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/26343884 Evaluation of housekeeping genes as references for quantitative real-time PCR analysis of gene expression in the murrel Channa striatus under high-temperature stress]
 +
|align="center"|2016
 +
|-
 +
|align="center"|[[Cichorium intybus]]
 +
|align="center"|Actin
 +
||
 +
* ''Different Tissues''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/20156357 Validation of reference genes for gene expression analysis in chicory (Cichorium intybus) using quantitative real-time PCR]
 +
|align="center"|2010
 +
|-
 +
|align="center"|[[Citrullus lanatus]]
 +
|align="center"|β-actin
 +
||
 +
* ''Fruit Development''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/26110539 Evaluation of Appropriate Reference Genes for Gene Expression Normalization during Watermelon Fruit Development]
 +
|align="center"|2015
 +
|-
 +
|align="center"|[[Citrus clementina]]
 +
|align="center"|Beta actin
 +
||
 +
* ''Different Genotypes''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/21633888 Selection of reference genes for quantitative real-time RT-PCR analysis in citrus. Molecular biology reports]
 +
|align="center"|2012
 +
|-
 +
|align="center"|[[Citrus japonica]]
 +
|align="center"|Actin 7
 +
||
 +
* ''Different Tissues & Abiotic Stress''
 +
||
 +
*[http://www.sciencedirect.com/science/article/pii/S0304423813006316 Selection of reference genes for real-time quantitative PCR studies of kumquat in various tissues and under abiotic stress]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Citrus maxima]]
 +
|align="center"|Beta actin
 +
||
 +
* ''Different Genotypes''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/21633888 Selection of reference genes for quantitative real-time RT-PCR analysis in citrus. Molecular biology reports]
 +
|align="center"|2012
 +
|-
 +
|align="center"|[[Citrus sinensis]]
 +
|align="center"|Beta actin
 +
||
 +
* ''Different Genotypes''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/21633888 Selection of reference genes for quantitative real-time RT-PCR analysis in citrus]
 +
|align="center"|2012
 +
|-
 +
|align="center"|[[Coffea arabica L.]]
 +
|align="center"|Actin
 +
||
 +
* ''Different Genotypes & Abiotic Stress''
 +
||
 +
*[https://link.springer.com/article/10.1007/s11105-011-0382-6 Selection of Reference Genes for Normalizing Quantitative Real-Time PCR Gene Expression Data with Multiple Variables in Coffea spp]
 +
|align="center"|2012
 +
|-
 +
|align="center"|[[Corchorus capsularis]]
 +
|align="center"|Actin 7
 +
||
 +
* ''Actin 7''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/26528312 Selection of reliable reference genes for quantitative real-time PCR gene expression analysis in Jute (Corchorus capsularis) under stress treatments]
 +
|align="center"|2015
 +
|-
 +
|align="center"|[[Cymbidium kanran]]
 +
|align="center"|Actin
 +
||
 +
* ''Abiotic Stress''
 +
||
 +
*[http://www.sciencedirect.com/science/article/pii/S0304423813006687 Evaluation of candidate reference genes for gene expression studies in Cymbidium kanran]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Delomys sublineatus]]
 +
|align="center"|Beta-actin
 +
||
 +
* ''Liver Samples''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/20059981 Selection and validation of reference genes for real-time RT-PCR studies in the non-model species Delomys sublineatus, an endemic Brazilian rodent. Biochemical and biophysical research communications]
 +
|align="center"|2010
 +
|-
 +
|align="center"|[[Diabrotica virgifera virgifera]]
 +
|align="center"|actin 2
 +
||
 +
* ''Different Developmental Stages & Tissues''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/25356627 Validation of reference housekeeping genes for gene expression studies in western corn rootworm (Diabrotica virgifera virgifera)]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Drosophila melanogaster]]
 +
|align="center"|Actin42A
 +
||
 +
* ''Physiological Responses''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/21435341 Evaluation of potential reference genes for reverse transcription-qPCR studies of physiological responses in Drosophila melanogaster]
 +
|align="center"|2011
 +
|-
 +
|align="center"|[[Eremosparton songoricum]]
 +
|align="center"|Actin
 +
||
 +
* ''Different Tissues & Abiotic Stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/22837673 Reference gene selection in the desert plant Eremosparton songoricum]
 +
|align="center"|2012
 +
|-
 +
|align="center"|[[Fagus sylvatica]]
 +
|align="center"|Actin
 +
||
 +
* ''Abiotic and Biotic Stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/18811005 Quantification of mRNAs and housekeeping gene selection for quantitative real-time RT-PCR normalization in European beech (Fagus sylvatica L.) during abiotic and biotic stress]
 +
|align="center"|2008
 +
|-
 +
|align="center"|[[Festuca arundinacea]]
 +
|align="center"|Actin7
 +
||
 +
* ''Abiotic Stresses''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/25786207 Identification and validation of reference genes for quantification of target gene expression with quantitative real-time PCR for tall fescue under four abiotic stresses]
 +
|align="center"|2015
 +
|-
 +
|align="center"|[[Fragaria ananassa]]
 +
|align="center"|Actin
 +
||
 +
* ''Different Developmental Stages & Tissues''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/?term=23940602 Identification and validation of reference genes for transcript normalization in strawberry (Fragaria× ananassa) defense responses]
 +
|align="center"|2013
 +
|-
 +
|align="center"|[[Gallus gallus]]
 +
|align="center"|Beta-actin
 +
||
 +
* ''Embryo Fibroblasts''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/21925148 Systematic selection of housekeeping genes for gene expression normalization in chicken embryo fibroblasts infected with Newcastle disease virus]
 +
|align="center"|2011
 +
|-
 +
|align="center"|[[Glycine max]]
 +
|align="center"|Actin
 +
||
 +
* ''Different Tissues & Abiotic Stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/23029532 Evaluation of candidate reference genes for normalization of quantitative RT-PCR in soybean tissues under various abiotic stress conditions]
 +
|align="center"|2012
 +
|-
 +
|align="center"|[[Glycine max]]
 +
|align="center"|Actin-11
 +
||
 +
* ''Hypoxic Condition''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/24615050 Reference genes for quantitative real-time polymerase chain reaction studies in soybean plants under hypoxic conditions]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Gossypium hirsutum]]
 +
|align="center"|Actin gene family
 +
||
 +
* ''Different Developmental Stages & Tissues''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/20302670 Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data]
 +
|align="center"|2010
 +
|-
 +
|align="center"|[[Haliotis discus hannai]]
 +
|align="center"|Actin
 +
||
 +
* ''Bacterial Infection''
 +
||
 +
*[https://link.springer.com/article/10.1007/s00343-013-2221-0 Identification of normalization factors for quantitative real-time RT-PCR analysis of gene expression in Pacific abalone Haliotis discus hannai]
 +
|align="center"|2013
 +
|-
 +
|align="center"|[[Homo sapiens]]
 +
|align="center"|β-actin
 +
||
 +
* ''Visceral Adipose Samples''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/20492695 Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples]
 +
|align="center"|2010
 +
|-
 +
|align="center"|[[Homo sapiens]]
 +
|align="center"|β-actin
 +
||
 +
* ''Lung Cancer''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/25573171 Identification of suitable reference genes for gene expression studies using quantitative polymerase chain reaction in lung cancer in vitro]
 +
|align="center"|2015
 +
|-
 +
|align="center"|[[Homo sapiens]]
 +
|align="center"|β-actin
 +
||
 +
* ''THP-1 Monocyte Differentiation Into Macrophages''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/21122122 Selection of reliable reference genes during THP-1 monocyte differentiation into macrophages]
 +
|align="center"|2010
 +
|-
 +
|align="center"|[[Homo sapiens]]
 +
|align="center"|β-actin
 +
||
 +
* ''Normal Thyroid & Goiter Tissue''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/24900955 Validation of reference genes for normalization gene expression in reverse transcription quantitative PCR in human normal thyroid and goiter tissue]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Homo sapiens]]
 +
|align="center"|β-actin
 +
||
 +
* ''Breast Cancer''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/23876162 High-throughput identification of reference genes for research and clinical RT-qPCR analysis of breast cancer samples]
 +
|align="center"|2013
 +
|-
 +
|align="center"|[[Hordeum vulgare]]
 +
|align="center"|Actin
 +
||
 +
* ''Different Developmental stages''
 +
||
 +
*[https://link.springer.com/article/10.1007/s11738-012-0967-1 Internal standards for quantitative RT-PCR studies of gene expression under drought treatment in barley (Hordeum vulgare L.): the effects of developmental stage and leaf age]
 +
|align="center"|2012
 +
|-
 +
|align="center"|[[Lilium davidii]]
 +
|align="center"|Actin
 +
||
 +
* ''Different Experimental Conditions''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/26509446 Validation of Reference Genes for Accurate Normalization of Gene Expression in Lilium davidii var. unicolor for Real Time Quantitative PCR]
 +
|align="center"|2015
 +
|-
 +
|align="center"|[[Mus musculus]]
 +
|align="center"|β-actin
 +
||
 +
* ''Preimplantation Embryos''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/25256308 Evaluation of reference genes in mouse preimplantation embryos for gene expression studies using real-time quantitative RT-PCR (RT-qPCR)]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Mus musculus]]
 +
|align="center"|β-actin
 +
||
 +
* ''Testis Development''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/24952483 Identification and validation of suitable reference genes for RT-qPCR analysis in mouse testis development]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Neurospora crassa]]
 +
|align="center"|Beta-actin
 +
||
 +
* ''Different Environmental Conditions''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/25474155 Selection and evaluation of reference genes for expression studies with quantitative PCR in the model fungus Neurospora crassa under different environmental conditions in continuous culture]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Oreochromis niloticus]]
 +
|align="center"|β-actin
 +
||
 +
* ''Vaccination & Infection''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/25941937 Evaluation and Selection of Appropriate Reference Genes for Real-Time Quantitative PCR Analysis of Gene Expression in Nile Tilapia (Oreochromis niloticus) during Vaccination and Infection]
 +
|align="center"|2015
 +
|-
 +
|align="center"|[[Oryza sativa]]
 +
|align="center"|Actin 1
 +
||
 +
* ''Seed Development''
 +
||
 +
*[Validation of candidate reference genes for the accurate normalization of real-time quantitative RT-PCR data in rice during seed development]
 +
|align="center"|2015
 +
|-
 +
|align="center"|[[Oxytropis ochrocephala]]
 +
|align="center"|Actin-7, Actin 101
 +
||
 +
* ''Abiotic Stress Treatments''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/26175743 Selection of appropriate reference genes for quantitative real-time PCR in Oxytropis ochrocephala Bunge using transcriptome datasets under abiotic stress treatments]
 +
|align="center"|2015
 +
|-
 +
|align="center"|[[Panax ginseng]]
 +
|align="center"|Actin 11
 +
||
 +
* ''Different Tissues & Abiotic Stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/26793228 Validation of Suitable Reference Genes for Quantitative Gene Expression Analysis in Panax ginseng]
 +
|align="center"|2016
 +
|-
 +
|align="center"|[[Penicillium echinulatum]]
 +
|align="center"|β-actin
 +
||
 +
* ''Culture Condition''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/24509829 Validation of reference genes in Penicillium echinulatum to enable gene expression study using real-time quantitative RT-PCR]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Pericallis cruenta]]
 +
|align="center"|Actin related protein 2
 +
||
 +
* ''Flower Development''
 +
||
 +
*[http://www.sciencedirect.com/science/article/pii/S0304423813000393 Reference gene selection for qPCR analysis in cineraria developing flowers]
 +
|align="center"|2013
 +
|-
 +
|align="center"|[[Peucedanum praeruptorum]]
 +
|align="center"|Actin 2
 +
||
 +
* ''Abiotic Stresses & Hormone Treatment & Different Tissues''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/27022972 Selection of reference genes for gene expression normalization in Peucedanum praeruptorum dunn under abiotic stresses, hormone treatments and different tissues]
 +
|align="center"|2016
 +
|-
 +
|align="center"|[[Phaseolus vulgaris]]
 +
|align="center"|Actin-11
 +
||
 +
* ''Biotic & Abiotic Stresses''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/23427655 Validation of internal reference genes for real-time quantitative polymerase chain reaction studies in the tick, Ixodes scapularis (Acari: Ixodidae)]
 +
|align="center"|2013
 +
|-
 +
|align="center"|[[Platycladus orientalis]]
 +
|align="center"|Actin 7
 +
||
 +
* ''Different Tissues & Abiotic Stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/22479379 Selection of reference genes for quantitative gene expression studies in Platycladus orientalis (Cupressaceae) using real-time PCR]
 +
|align="center"|2012
 +
|-
 +
|align="center"|[[Plukenetia volubilis]]
 +
|align="center"|Actin
 +
||
 +
* ''Different Developmental Stages & Tissues''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/26047338 Selection of Reliable Reference Genes for Gene Expression Studies of a Promising Oilseed Crop, Plukenetia volubilis, by Real-Time Quantitative PCR]
 +
|align="center"|2015
 +
|-
 +
|align="center"|[[Plutella xylostella]]
 +
|align="center"|β-actin
 +
||
 +
* ''Different Developmental Stages & Tissues & Abiotic Stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/23983612 Exploring valid reference genes for quantitative real-time PCR analysis in Plutella xylostella (Lepidoptera: Plutellidae)]
 +
|align="center"|2013
 +
|-
 +
|align="center"|[[Poa pratensis]]
 +
|align="center"|Actin7
 +
||
 +
* ''Different Tissues & Abiotic Stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/28261247 Selection of Candidate Reference Genes for Gene Expression Analysis in Kentucky Bluegrass (Poa pratensis L.) under Abiotic Stress]
 +
|align="center"|2017
 +
|-
 +
|align="center"|[[Pyropia yezoensis]]
 +
|align="center"|Actin3
 +
||
 +
* ''Different Developmental Stages & Abiotic Stress''
 +
||
 +
*[https://link.springer.com/article/10.1007/s10811-014-0359-6 Selection of reference genes for gene expression normalization in Pyropia yezoensis using quantitative real-time PCR]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Quercus suber]]
 +
|align="center"|Actin
 +
||
 +
* ''Different Tissues''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/22529976 Reference gene selection for quantitative real-time PCR normalization in Quercus suber]
 +
|align="center"|2012
 +
|-
 +
|align="center"|[[Raphanus sativus]]
 +
|align="center"|Actin 2/7
 +
||
 +
* ''Different Tissues & Cultivars & Developmental Stages''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/22771808 Evaluation of reference genes for gene expression studies in radish (Raphanus sativus L.) using quantitative real-time PCR]
 +
|align="center"|2012
 +
|-
 +
|align="center"|[[Rattus norvegicus]]
 +
|align="center"|β-actin
 +
||
 +
* ''Cardiosphere-derived Cells''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/22065248 Identification of valid housekeeping genes for quantitative RT-PCR analysis of cardiosphere-derived cells preconditioned under hypoxia or with prolyl-4-hydroxylase inhibitors]
 +
|align="center"|2012
 +
|-
 +
|align="center"|[[Rattus norvegicus]]
 +
|align="center"|β-actin
 +
||
 +
* ''Adipose Tissue''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/27338366 Selection of suitable reference genes for quantitative real-time PCR normalization in three types of rat adipose tissue]
 +
|align="center"|2016
 +
|-
 +
|align="center"|[[Rattus norvegicus]]
 +
|align="center"|β-actin
 +
||
 +
* ''Borna Disease Viral Infection''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/25431926 Real-time qPCR identifies suitable reference genes for Borna disease virus-infected rat cortical neurons]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Rhodnius prolixus]]
 +
|align="center"|β-actin
 +
||
 +
* ''Different Experimental Conditions''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/22395020 Validation of reference genes for expression analysis in the salivary gland and the intestine of Rhodnius prolixus (Hemiptera, Reduviidae) under different experimental conditions by quantitative real-time PCR]
 +
|align="center"|2012
 +
|-
 +
|align="center"|[[Salicornia europaea]]
 +
|align="center"|Actin
 +
||
 +
* ''Abiotic Stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/25653658 Validation of suitable reference genes for gene expression analysis in the halophyte Salicornia europaea by real-time quantitative PCR]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Salvia miltiorrhiza]]
 +
|align="center"|Cytoskeletal structural protein
 +
||
 +
* ''Different Tissues''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/19680786 Characterization of reference genes for quantitative real-time PCR analysis in various tissues of Salvia miltiorrhiza]
 +
|align="center"|2010
 +
|-
 +
|align="center"|[[Scophthalmus maximus]]
 +
|align="center"|β-actin
 +
||
 +
* ''Viral Infection''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/23332581 Selection of normalization factors for quantitative real time RT-PCR studies in Japanese flounder (Paralichthys olivaceus) and turbot (Scophthalmus maximus) under conditions of viral infection]
 
|align="center"|2013
 
|align="center"|2013
 
|-
 
|-
|align="center"|[[Vitis vinifera]]
+
|align="center"|[[Sebastes schlegeli]]
|align="center"|SAND
+
|align="center"|β-Actin
 
||
 
||
* ''Mycotic Infection''
+
* ''Different Developmental Stages & Tissues''
 
||
 
||
*[https://www.ncbi.nlm.nih.gov/pubmed/24023800 Reference gene selection and validation for the early responses to downy mildew infection in susceptible and resistant Vitis vinifera cultivars]
+
*[https://www.ncbi.nlm.nih.gov/pubmed/24007945 Selection of reference genes for reverse transcription quantitative real-time PCR normalization in black rockfish (Sebastes schlegeli)]
 
|align="center"|2013
 
|align="center"|2013
 +
|-
 +
|align="center"|[[Sesamum indicum]]
 +
|align="center"|Actin 7
 +
||
 +
* ''Different Developmental Stages & Abiotic Stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/23229061 Identification and testing of reference genes for Sesame gene expression analysis by quantitative real-time PCR]
 +
|align="center"|2013
 +
|-
 +
|align="center"|[[Setaria italica]]
 +
|align="center"|Actin2
 +
||
 +
* ''Dehydration & Salinity Treatment''
 +
||
 +
*[https://link.springer.com/article/10.1007/s11240-013-0335-x Reference genes for quantitative real-time PCR analysis in the model plant foxtail millet (Setariaitalica L.) subjected to abiotic stress conditions]
 +
|align="center"|2013
 +
|-
 +
|align="center"|[[Solanum lycopersicum]]
 +
|align="center"|Actin
 +
||
 +
* ''Viral Infection''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/21029324 Evaluation of reference genes for quantitative reverse�\transcription polymerase chain reaction normalization in infected tomato plants]
 +
|align="center"|2010
 +
|-
 +
|align="center"|[[Spodoptera exigua]]
 +
|align="center"|β-actin1, β-actin2
 +
||
 +
* ''Different Developmental Stages & Tissues''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/24454743 Selection and evaluation of reference genes for expression analysis using qRT-PCR in the beet armyworm Spodoptera exigua (Hubner) (Lepidoptera: Noctuidae)]
 +
|align="center"|2014
 +
|-
 +
|align="center"|[[Spodoptera litura]]
 +
|align="center"|Actin
 +
||
 +
* ''Abiotic & Biotic treatments''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/23874494 Identification and validation of reference genes for gene expression analysis using quantitative PCR in Spodoptera litura (Lepidoptera: Noctuidae)]
 +
|align="center"|2013
 +
|-
 +
|align="center"|[[Stipa grandis]]
 +
|align="center"|Actin-7
 +
||
 +
* ''Abiotic Stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/28056110 Selection of Reference Genes for qRT-PCR Analysis of Gene Expression in Stipa grandis during Environmental Stresses]
 +
|align="center"|2017
 +
|-
 +
|align="center"|[[Talaromyces marneffei]]
 +
|align="center"|β-actin
 +
||
 +
* ''Specific Cells''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/26327538 Validation of reference genes for real-time quantitative RT-PCR studies in Talaromyces marneffei]
 +
|align="center"|2015
 +
|-
 +
|align="center"|[[Vernicia fordii]]
 +
|align="center"|Actin7a
 +
||
 +
* ''Seed Development''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/22912794 Selection of reliable reference genes for gene expression studies using real-time PCR in tung tree during seed development]
 +
|align="center"|2012
 +
|-
 +
|align="center"|[[Vigna mungo]]
 +
|align="center"|Actin
 +
||
 +
* ''Biotic and Abiotic stress''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/23868569 Defining reference genes for qPCR normalization to study biotic and abiotic stress responses in Vigna mungo]
 +
|align="center"|2013
 +
|-
 +
|align="center"|[[Zea mays]]
 +
|align="center"|Actin 1 gene
 +
||
 +
* ''Landrace Varieties & During Grain Development''
 +
||
 +
*[https://www.ncbi.nlm.nih.gov/pubmed/24013792 Selection of reliable reference genes for quantitative real-time polymerase chain reaction studies in maize grains]
 +
|align="center"|2013
 +
 
|}
 
|}
  
 +
=='''Featured Sequence'''==
 +
{{DNA|
 +
DNA = <dnaseqindica>ACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGTCCACACCC
 +
GCCGCCAGCTCACCATGGATGATGATATCGCCGCGCTCGTCGTCGACAACGGCTCCGGCATGTGCAAGGC
 +
CGGCTTCGCGGGCGACGATGCCCCCCGGGCCGTCTTCCCCTCCATCGTGGGGCGCCCCAGGCACCAGGGC
 +
GTGATGGTGGGCATGGGTCAGAAGGATTCCTATGTGGGCGACGAGGCCCAGAGCAAGAGAGGCATCCTCA
 +
CCCTGAAGTACCCCATCGAGCACGGCATCGTCACCAACTGGGACGACATGGAGAAAATCTGGCACCACAC
 +
CTTCTACAATGAGCTGCGTGTGGCTCCCGAGGAGCACCCCGTGCTGCTGACCGAGGCCCCCCTGAACCCC
 +
AAGGCCAACCGCGAGAAGATGACCCAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTTGCTA
 +
TCCAGGCTGTGCTATCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCCGGTGACGGGGT
 +
CACCCACACTGTGCCCATCTACGAGGGGTATGCCCTCCCCCATGCCATCCTGCGTCTGGACCTGGCTGGC
 +
CGGGACCTGACTGACTACCTCATGAAGATCCTCACCGAGCGCGGCTACAGCTTCACCACCACGGCCGAGC
 +
GGGAAATCGTGCGTGACATTAAGGAGAAGCTGTGCTACGTCGCCCTGGACTTCGAGCAAGAGATGGCCAC
 +
GGCTGCTTCCAGCTCCTCCCTGGAGAAGAGCTACGAGCTGCCTGACGGCCAGGTCATCACCATTGGCAAT
 +
GAGCGGTTCCGCTGCCCTGAGGCACTCTTCCAGCCTTCCTTCCTGGGCATGGAGTCCTGTGGCATCCACG
 +
AAACTACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCCAACACAGTGCT
 +
GTCTGGCGGCACCACCATGTACCCTGGCATTGCCGACAGGATGCAGAAGGAGATCACTGCCCTGGCACCC
 +
AGCACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAAGTACTCCGTGTGGATCGGCGGCTCCATCC
 +
TGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTATGACGAGTCCGGCCCCTCCAT
 +
CGTCCACCGCAAATGCTTCTAGGCGGACTATGACTTAGTTGCGTTACACCCTTTCTTGACAAAACCTAAC
 +
TTGCGCAGAAAACAAGATGAGATTGGCATGGCTTTATTTGTTTTTTTTGTTTTGTTTTGGTTTTTTTTTT
 +
TTTTTTGGCTTGACTCAGGATTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATC
 +
CCCCAAAGTTCACAATGTGGCCGAGGACTTTGATTGCACATTGTTGTTTTTTTAATAGTCATTCCAAATA
 +
TGAGATGCGTTGTTACAGGAAGTCCCTTGCCATCCTAAAAGCCACCCCACTTCTCTCTAAGGAGAATGGC
 +
CCAGTCCTCTCCCAAGTCCACACAGGGGAGGTGATAGCATTGCTTTCGTGTAAATTATGTAATGCAAAAT
 +
TTTTTTAATCTTCGCCTTAATACTTTTTTATTTTGTTTTATTTTGAATGATGAGCCTTCGTGCCCCCCCT
 +
TCCCCCTTTTTTGTCCCCCAACTTGAGATGTATGAAGGCTTTTGGTCTCCCTGGGAGTGGGTGGAGGCAG
 +
CCAGGGCTTACCTGTACACTGACTTGAGACCAGTTGAATAAAAGTGCACACCTTAAAAATGAAAAAAAAA
 +
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
 +
</dnaseqindica>|
 +
SOURCE = '''''Homo sapiens''''' ACT|
  
 +
}}
  
 +
=='''Conserved Domains '''==
 +
{{Str|
 +
SOURCE = '''''Homo sapiens''''' ACT|
 +
Str= [[File:ACT.png|center|770px|link=http://icg.big.ac.cn/index.php/Gene:ACT]]|
 +
}}
  
 
+
=='''External Links'''==
 
+
* [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?ascbin=8&maxaln=10&seltype=2&uid=smart00268 NCBI Conserved Protein Domain Family]
 
+
* [https://en.wikipedia.org/wiki/Actin WikiPedia]
 
+
* [http://pfam.xfam.org/family/PF00022 Pfam]
 
+
* [https://www.ebi.ac.uk/interpro/entry/IPR004000 InterPro]
 
+
* [http://smart.embl-heidelberg.de/smart/do_annotation.pl?BLAST=DUMMY&DOMAIN=SM00268 SMART]
==External Links==
 
* [https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?uid=pfam01342 NCBI COnserved Protein Domain Family]
 
* [https://en.wikipedia.org/wiki/SAND_DNA-binding_protein_domain WikiPedia]
 
* [http://pfam.xfam.org/family/SAND Pfam]
 

Latest revision as of 02:15, 30 August 2017

Synonymous Genes

  • ACT <=> Actin, Actin7, beta-actin, Actin 11, Actin1, Actin2, Actin3, Actin5, β-actin, Actin42A, Actin-11, Actin 101, Actin-11, β-actin1, β-actin2

Applicable Species

Species Gene Synonymous Application scenarios Publication Year
Actinidia chinensis Actin
  • Different Developmental Stages & Tissues
2016
Agrostis stolonifera Actin7
  • Abiotic Stresses
2015
Aphis gossypii beta-actin
  • Different Developmental Stages & Geographical Populations
2016
Apis mellifera Actin
  • Bacterial Challenge
2008
Arachis hypogaea Actin 11
  • Different Developmental Stages & Abiotic Stress
2012
Artemisia annua Actin
  • Different Tissues & Abiotic Stress
2014
Aspergillus niger Actin
  • Continuous Cultivation
2007
Bactrocera dorsalis Actin1, Actin2, Actin3, Actin5
  • Different Sex & Tissues
2010
Bos indicus β-actin
  • Milk Somatic Cells
2012
Brassica napus Actin7
  • Abiotic & Biotic Stress
2014
Brassica rapa subsp. pekinensis Actin2
  • Different Developmental Stages & Biotic Stress
2012
Callithrix jacchus b-Actin
  • Different Tissues
2013
Channa striatus beta-actin
  • High-temperature Stress
2016
Cichorium intybus Actin
  • Different Tissues
2010
Citrullus lanatus β-actin
  • Fruit Development
2015
Citrus clementina Beta actin
  • Different Genotypes
2012
Citrus japonica Actin 7
  • Different Tissues & Abiotic Stress
2014
Citrus maxima Beta actin
  • Different Genotypes
2012
Citrus sinensis Beta actin
  • Different Genotypes
2012
Coffea arabica L. Actin
  • Different Genotypes & Abiotic Stress
2012
Corchorus capsularis Actin 7
  • Actin 7
2015
Cymbidium kanran Actin
  • Abiotic Stress
2014
Delomys sublineatus Beta-actin
  • Liver Samples
2010
Diabrotica virgifera virgifera actin 2
  • Different Developmental Stages & Tissues
2014
Drosophila melanogaster Actin42A
  • Physiological Responses
2011
Eremosparton songoricum Actin
  • Different Tissues & Abiotic Stress
2012
Fagus sylvatica Actin
  • Abiotic and Biotic Stress
2008
Festuca arundinacea Actin7
  • Abiotic Stresses
2015
Fragaria ananassa Actin
  • Different Developmental Stages & Tissues
2013
Gallus gallus Beta-actin
  • Embryo Fibroblasts
2011
Glycine max Actin
  • Different Tissues & Abiotic Stress
2012
Glycine max Actin-11
  • Hypoxic Condition
2014
Gossypium hirsutum Actin gene family
  • Different Developmental Stages & Tissues
2010
Haliotis discus hannai Actin
  • Bacterial Infection
2013
Homo sapiens β-actin
  • Visceral Adipose Samples
2010
Homo sapiens β-actin
  • Lung Cancer
2015
Homo sapiens β-actin
  • THP-1 Monocyte Differentiation Into Macrophages
2010
Homo sapiens β-actin
  • Normal Thyroid & Goiter Tissue
2014
Homo sapiens β-actin
  • Breast Cancer
2013
Hordeum vulgare Actin
  • Different Developmental stages
2012
Lilium davidii Actin
  • Different Experimental Conditions
2015
Mus musculus β-actin
  • Preimplantation Embryos
2014
Mus musculus β-actin
  • Testis Development
2014
Neurospora crassa Beta-actin
  • Different Environmental Conditions
2014
Oreochromis niloticus β-actin
  • Vaccination & Infection
2015
Oryza sativa Actin 1
  • Seed Development
  • [Validation of candidate reference genes for the accurate normalization of real-time quantitative RT-PCR data in rice during seed development]
2015
Oxytropis ochrocephala Actin-7, Actin 101
  • Abiotic Stress Treatments
2015
Panax ginseng Actin 11
  • Different Tissues & Abiotic Stress
2016
Penicillium echinulatum β-actin
  • Culture Condition
2014
Pericallis cruenta Actin related protein 2
  • Flower Development
2013
Peucedanum praeruptorum Actin 2
  • Abiotic Stresses & Hormone Treatment & Different Tissues
2016
Phaseolus vulgaris Actin-11
  • Biotic & Abiotic Stresses
2013
Platycladus orientalis Actin 7
  • Different Tissues & Abiotic Stress
2012
Plukenetia volubilis Actin
  • Different Developmental Stages & Tissues
2015
Plutella xylostella β-actin
  • Different Developmental Stages & Tissues & Abiotic Stress
2013
Poa pratensis Actin7
  • Different Tissues & Abiotic Stress
2017
Pyropia yezoensis Actin3
  • Different Developmental Stages & Abiotic Stress
2014
Quercus suber Actin
  • Different Tissues
2012
Raphanus sativus Actin 2/7
  • Different Tissues & Cultivars & Developmental Stages
2012
Rattus norvegicus β-actin
  • Cardiosphere-derived Cells
2012
Rattus norvegicus β-actin
  • Adipose Tissue
2016
Rattus norvegicus β-actin
  • Borna Disease Viral Infection
2014
Rhodnius prolixus β-actin
  • Different Experimental Conditions
2012
Salicornia europaea Actin
  • Abiotic Stress
2014
Salvia miltiorrhiza Cytoskeletal structural protein
  • Different Tissues
2010
Scophthalmus maximus β-actin
  • Viral Infection
2013
Sebastes schlegeli β-Actin
  • Different Developmental Stages & Tissues
2013
Sesamum indicum Actin 7
  • Different Developmental Stages & Abiotic Stress
2013
Setaria italica Actin2
  • Dehydration & Salinity Treatment
2013
Solanum lycopersicum Actin
  • Viral Infection
2010
Spodoptera exigua β-actin1, β-actin2
  • Different Developmental Stages & Tissues
2014
Spodoptera litura Actin
  • Abiotic & Biotic treatments
2013
Stipa grandis Actin-7
  • Abiotic Stress
2017
Talaromyces marneffei β-actin
  • Specific Cells
2015
Vernicia fordii Actin7a
  • Seed Development
2012
Vigna mungo Actin
  • Biotic and Abiotic stress
2013
Zea mays Actin 1 gene
  • Landrace Varieties & During Grain Development
2013

Featured Sequence

The Sequence of Homo sapiens ACT is displayed as example.

000001 ACCGCCGAGA CCGCGTCCGC CCCGCGAGCA CAGAGCCTCG CCTTTGCCGA TCCGCCGCCC GTCCACACCC 000070
000071 GCCGCCAGCT CACCATGGAT GATGATATCG CCGCGCTCGT CGTCGACAAC GGCTCCGGCA TGTGCAAGGC 000140
000141 CGGCTTCGCG GGCGACGATG CCCCCCGGGC CGTCTTCCCC TCCATCGTGG GGCGCCCCAG GCACCAGGGC 000210
000211 GTGATGGTGG GCATGGGTCA GAAGGATTCC TATGTGGGCG ACGAGGCCCA GAGCAAGAGA GGCATCCTCA 000280
000281 CCCTGAAGTA CCCCATCGAG CACGGCATCG TCACCAACTG GGACGACATG GAGAAAATCT GGCACCACAC 000350
000351 CTTCTACAAT GAGCTGCGTG TGGCTCCCGA GGAGCACCCC GTGCTGCTGA CCGAGGCCCC CCTGAACCCC 000420
000421 AAGGCCAACC GCGAGAAGAT GACCCAGATC ATGTTTGAGA CCTTCAACAC CCCAGCCATG TACGTTGCTA 000490
000491 TCCAGGCTGT GCTATCCCTG TACGCCTCTG GCCGTACCAC TGGCATCGTG ATGGACTCCG GTGACGGGGT 000560
000561 CACCCACACT GTGCCCATCT ACGAGGGGTA TGCCCTCCCC CATGCCATCC TGCGTCTGGA CCTGGCTGGC 000630
000631 CGGGACCTGA CTGACTACCT CATGAAGATC CTCACCGAGC GCGGCTACAG CTTCACCACC ACGGCCGAGC 000700
000701 GGGAAATCGT GCGTGACATT AAGGAGAAGC TGTGCTACGT CGCCCTGGAC TTCGAGCAAG AGATGGCCAC 000770
000771 GGCTGCTTCC AGCTCCTCCC TGGAGAAGAG CTACGAGCTG CCTGACGGCC AGGTCATCAC CATTGGCAAT 000840
000841 GAGCGGTTCC GCTGCCCTGA GGCACTCTTC CAGCCTTCCT TCCTGGGCAT GGAGTCCTGT GGCATCCACG 000910
000911 AAACTACCTT CAACTCCATC ATGAAGTGTG ACGTGGACAT CCGCAAAGAC CTGTACGCCA ACACAGTGCT 000980
000981 GTCTGGCGGC ACCACCATGT ACCCTGGCAT TGCCGACAGG ATGCAGAAGG AGATCACTGC CCTGGCACCC 001050
001051 AGCACAATGA AGATCAAGAT CATTGCTCCT CCTGAGCGCA AGTACTCCGT GTGGATCGGC GGCTCCATCC 001120
001121 TGGCCTCGCT GTCCACCTTC CAGCAGATGT GGATCAGCAA GCAGGAGTAT GACGAGTCCG GCCCCTCCAT 001190
001191 CGTCCACCGC AAATGCTTCT AGGCGGACTA TGACTTAGTT GCGTTACACC CTTTCTTGAC AAAACCTAAC 001260
001261 TTGCGCAGAA AACAAGATGA GATTGGCATG GCTTTATTTG TTTTTTTTGT TTTGTTTTGG TTTTTTTTTT 001330
001331 TTTTTTGGCT TGACTCAGGA TTTAAAAACT GGAACGGTGA AGGTGACAGC AGTCGGTTGG AGCGAGCATC 001400
001401 CCCCAAAGTT CACAATGTGG CCGAGGACTT TGATTGCACA TTGTTGTTTT TTTAATAGTC ATTCCAAATA 001470
001471 TGAGATGCGT TGTTACAGGA AGTCCCTTGC CATCCTAAAA GCCACCCCAC TTCTCTCTAA GGAGAATGGC 001540
001541 CCAGTCCTCT CCCAAGTCCA CACAGGGGAG GTGATAGCAT TGCTTTCGTG TAAATTATGT AATGCAAAAT 001610
001611 TTTTTTAATC TTCGCCTTAA TACTTTTTTA TTTTGTTTTA TTTTGAATGA TGAGCCTTCG TGCCCCCCCT 001680
001681 TCCCCCTTTT TTGTCCCCCA ACTTGAGATG TATGAAGGCT TTTGGTCTCC CTGGGAGTGG GTGGAGGCAG 001750
001751 CCAGGGCTTA CCTGTACACT GACTTGAGAC CAGTTGAATA AAAGTGCACA CCTTAAAAAT GAAAAAAAAA 001820
001821 AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AA

Conserved Domains

The Conserved domains of Homo sapiens ACT is displayed as example.

ACT.png

External Links